ID: 952445087

View in Genome Browser
Species Human (GRCh38)
Location 3:33373390-33373412
Sequence TCCAGAATGTTCATAGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 783}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952445087_952445090 0 Left 952445087 3:33373390-33373412 CCCAAAGCTATGAACATTCTGGA 0: 1
1: 0
2: 8
3: 71
4: 783
Right 952445090 3:33373413-33373435 AACCTTCTTAATGGTCACGTTGG 0: 1
1: 0
2: 1
3: 1
4: 69
952445087_952445094 30 Left 952445087 3:33373390-33373412 CCCAAAGCTATGAACATTCTGGA 0: 1
1: 0
2: 8
3: 71
4: 783
Right 952445094 3:33373443-33373465 AAGAAATAGGTGACTCCAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 185
952445087_952445089 -9 Left 952445087 3:33373390-33373412 CCCAAAGCTATGAACATTCTGGA 0: 1
1: 0
2: 8
3: 71
4: 783
Right 952445089 3:33373404-33373426 CATTCTGGAAACCTTCTTAATGG 0: 1
1: 0
2: 0
3: 14
4: 215
952445087_952445092 17 Left 952445087 3:33373390-33373412 CCCAAAGCTATGAACATTCTGGA 0: 1
1: 0
2: 8
3: 71
4: 783
Right 952445092 3:33373430-33373452 CGTTGGATCCAGCAAGAAATAGG 0: 1
1: 0
2: 1
3: 9
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952445087 Original CRISPR TCCAGAATGTTCATAGCTTT GGG (reversed) Intronic
900915023 1:5631144-5631166 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
905712026 1:40113329-40113351 TCCAGGATTTTTATAGTTTTAGG - Intergenic
906360641 1:45154930-45154952 TCTAGAATTTTTATAGTTTTAGG - Intronic
906721741 1:48011143-48011165 TCTAGAATTTTTATAGTTTTAGG + Intergenic
906808036 1:48798622-48798644 TCCAGAATTTTTATGGTTTTAGG + Intronic
907122925 1:52023362-52023384 TCCTGCATGTCTATAGCTTTTGG - Intronic
907563761 1:55415364-55415386 TCCAGAATTTTTATAACTTCAGG + Intergenic
907686078 1:56613038-56613060 TCCAGGATTTTTATAGTTTTAGG - Intronic
908072702 1:60480789-60480811 TCCAGGATGTTCAGCTCTTTAGG - Intergenic
908372523 1:63497331-63497353 TCCAGAATGTTCAAAAGTTAAGG - Intronic
908587641 1:65589528-65589550 TCTAGAAGTTTCATAGCTTTAGG + Intronic
908614152 1:65898845-65898867 TCTAGAATTTTTATAGTTTTAGG - Intronic
908668014 1:66513818-66513840 TCTAGAATGTTCATGGTTTCAGG - Intergenic
908890405 1:68840545-68840567 TCTAGAATGTTTATAGTTTCAGG + Intergenic
909043497 1:70682429-70682451 TCTAGAATTTTTATAGTTTTAGG + Intergenic
909177980 1:72383889-72383911 TTCAGAATTTTTATAGCTTGCGG - Intergenic
909771967 1:79434983-79435005 AACCTAATGTTCATAGCTTTGGG + Intergenic
910207448 1:84762286-84762308 TCTAAAACGTTGATAGCTTTGGG + Intergenic
910358559 1:86391728-86391750 TCCAGAATTTTTATAGTTTCAGG - Intronic
911666139 1:100554971-100554993 TCCAGAATTTTTATAGTTTCAGG - Intergenic
911667767 1:100573327-100573349 TCCAGGATTTTTATAGTTTTGGG - Intergenic
911847293 1:102770479-102770501 TCCAGAATATTTATAGTTTCAGG - Intergenic
911892159 1:103385142-103385164 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
912314423 1:108653998-108654020 TCCAGTACTTTCATAGTTTTAGG + Intronic
912592756 1:110843187-110843209 TCCAGTAGTTTCATAGCTTTGGG + Intergenic
912610609 1:111039305-111039327 TCTAGTATTTTCATAGTTTTTGG - Intergenic
912647657 1:111410146-111410168 TCCAGAGTTTTTATAGTTTTTGG - Intergenic
912743795 1:112227474-112227496 TCCAGTAGTTTCATAGTTTTAGG - Intergenic
913226063 1:116699545-116699567 TCAAAATTGTTCATAGATTTTGG - Intronic
913406552 1:118499698-118499720 TCTAGAACTTTCATAGGTTTAGG - Intergenic
914329360 1:146651677-146651699 TCCAGGATTTTTATAGTTTTAGG - Intergenic
914842131 1:151257054-151257076 TCCAGGATTTTTATAGTTTTGGG + Intronic
915000890 1:152589596-152589618 TCCAGAATTTTTATAGTTTGAGG - Intronic
916175098 1:162031507-162031529 ACCAGAATTCTCATAGCCTTTGG - Intergenic
916581039 1:166109038-166109060 TCTAGAATTTTTATAGTTTTGGG - Intronic
916725872 1:167523234-167523256 TCCAGAAATTTTATAGTTTTGGG - Intergenic
916984057 1:170171481-170171503 TCCAGGATTTTTATAGTTTTGGG + Intergenic
917003623 1:170387783-170387805 TCCAGAGTTTTCTTAGTTTTAGG + Intergenic
917181313 1:172301199-172301221 TTAAGAATGATCATAACTTTAGG + Intronic
918442988 1:184586894-184586916 TCCAGAGTTTTTATAGTTTTGGG + Intronic
918489704 1:185068302-185068324 ACCAGAATGTAGATATCTTTTGG - Intronic
918930276 1:190846576-190846598 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
918989618 1:191681908-191681930 TCTAGGATATTCATAGTTTTGGG + Intergenic
919141028 1:193571849-193571871 TCCAGGGTTTTCATAGTTTTAGG + Intergenic
919170404 1:193947267-193947289 TCCAGAATTTTCATAATTTTCGG - Intergenic
919187442 1:194171022-194171044 TCTAGAATGTTTATAGTTTTGGG + Intergenic
919268896 1:195312818-195312840 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
920935107 1:210425453-210425475 TCCAGGATTTTTATAGTTTTGGG + Intronic
921529603 1:216264945-216264967 TCTAGTATTTTCATAGTTTTGGG - Intronic
922995527 1:229955760-229955782 TCTAGAATTTTTATAGTTTTGGG + Intergenic
923192978 1:231638449-231638471 TCTAGTATGTTTATAGTTTTGGG + Intronic
923930255 1:238686274-238686296 TTCAGGATTTTTATAGCTTTGGG - Intergenic
924667929 1:246092638-246092660 TCTAGTAGCTTCATAGCTTTGGG - Intronic
1063429067 10:5973700-5973722 TCTAGAAGTTTTATAGCTTTAGG - Intronic
1064336239 10:14445416-14445438 GCCAGTATCTTCATAGCTTGGGG + Intronic
1064801588 10:19080647-19080669 TCTAGAATGTTTATAGTTTTAGG - Intronic
1064830833 10:19464321-19464343 TCTAGAATTTTTATAGCTTCAGG + Intronic
1065079574 10:22114506-22114528 TCTAGAATTTTTATAGCTTCAGG + Intergenic
1065156815 10:22878388-22878410 TCTAGAATGTTTATGGCTTCTGG + Intergenic
1065372667 10:25004872-25004894 TCCAGGATTTTTATAGTTTTGGG + Intronic
1066136987 10:32458139-32458161 TCCAGTAGTTTCATAGTTTTGGG + Intronic
1066137762 10:32467696-32467718 TCCAGAATTTTTATAGTTTTGGG + Intronic
1066144015 10:32537605-32537627 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1066182489 10:32976874-32976896 TTCAGAATGTGCAGGGCTTTGGG + Intronic
1066753283 10:38682389-38682411 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1067043082 10:42968479-42968501 TCTAGAATTTTCATAGTTTCAGG + Intergenic
1068136724 10:52956245-52956267 ATTAGAATGTTCATACCTTTGGG + Intergenic
1068150557 10:53125349-53125371 TTCAGTCTGTTCATAGATTTAGG + Intergenic
1068314767 10:55325597-55325619 TCCAGGATGTTTATAGTTTTAGG - Intronic
1068890470 10:62143438-62143460 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1068891430 10:62152127-62152149 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1069199999 10:65601786-65601808 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
1069232620 10:66030587-66030609 TCTAGGATTTTCATAGGTTTAGG - Intronic
1069362731 10:67661442-67661464 TCTAGAAGTTTAATAGCTTTAGG - Intronic
1070054046 10:72917272-72917294 TCCAGGATTTTTATAGTTTTGGG + Intronic
1070857953 10:79622859-79622881 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
1070871041 10:79753306-79753328 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1071063193 10:81598573-81598595 TCCAGGGTTTTCATAGCTTTTGG - Intergenic
1071637971 10:87275519-87275541 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1071657274 10:87462432-87462454 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1071736625 10:88308157-88308179 TCCAGGGTGTTTATAGCGTTGGG - Intronic
1071754965 10:88527314-88527336 TCCCAAATGTTAATATCTTTAGG - Intronic
1071811883 10:89191066-89191088 TCTAGAATGTTTATAGTTTCAGG + Intergenic
1072357891 10:94629852-94629874 TCTAGAATTTTTATAGTTTTGGG + Intergenic
1073832375 10:107400155-107400177 TTCAGAATTTTTATAGATTTGGG + Intergenic
1074013779 10:109511491-109511513 TCCAGAATTTTTATAGTTTTAGG + Intergenic
1074557455 10:114504782-114504804 TTCAGAAAGTACATAGCATTGGG - Intronic
1074566439 10:114582891-114582913 TCCAGAATTTTTGTAGTTTTAGG - Intronic
1074920085 10:117999410-117999432 TCCAGAAGGTCCCTTGCTTTGGG + Intergenic
1075500441 10:122968642-122968664 TCCAGAATCTTTATAGCTTTGGG - Intronic
1077734276 11:4772276-4772298 TACACACTGTTCATAGCATTGGG + Intronic
1077984401 11:7336451-7336473 TCCAGGATTTTTATAGTTTTGGG + Intronic
1078816541 11:14828199-14828221 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1078946690 11:16076140-16076162 TCCAGGATTTTTATAGTTTTAGG - Intronic
1078979790 11:16520309-16520331 TCCAGAATTTTTATAGATTCAGG + Intronic
1079608837 11:22405148-22405170 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1079764261 11:24370978-24371000 TCTAGAATTTTTATAGTTTTGGG + Intergenic
1080402711 11:31951908-31951930 TCTAGAATTTTTATAGTTTTGGG - Intronic
1080709098 11:34729117-34729139 TCCAGGATTTTTATAGCTTGAGG + Intergenic
1081020530 11:37942209-37942231 TCGAGAATTTTTATAGCTTGAGG + Intergenic
1081106117 11:39072001-39072023 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1082685869 11:56238777-56238799 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1082712304 11:56567818-56567840 TCCAGGATTTTTATAGCTTTAGG + Intergenic
1083046990 11:59745761-59745783 TCCAGAGTTTTCAGAGCTATTGG + Intronic
1085222511 11:74887095-74887117 TCCAGAATTTTTATAATTTTAGG - Intronic
1085353869 11:75818103-75818125 TCCAGGATGTTAATAATTTTGGG - Intronic
1085623203 11:78052681-78052703 ACCTGAATGTTCTCAGCTTTTGG - Intronic
1085748319 11:79134873-79134895 TCTAGAATTTTTATAGTTTTAGG - Intronic
1086740384 11:90360939-90360961 TCCAGAGTTTTTATAGTTTTTGG + Intergenic
1087154373 11:94886347-94886369 TCCAGAATGTCCCTATTTTTTGG + Intergenic
1087383950 11:97446045-97446067 TCCAGACTGTATATATCTTTGGG - Intergenic
1087414026 11:97829689-97829711 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1087429549 11:98035220-98035242 TCTAGAATGTTTATAGTTTCAGG - Intergenic
1087688541 11:101292922-101292944 TCTAGAATTTTCATAGTTTTAGG + Intergenic
1088052134 11:105529852-105529874 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
1088951550 11:114576230-114576252 TCTAGAATCTTCATGGCTTCAGG - Intronic
1088992664 11:114967769-114967791 TCTAGAATGTTTATGGTTTTAGG + Intergenic
1090162162 11:124506984-124507006 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1090169515 11:124587327-124587349 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1090559088 11:127910640-127910662 TCTAGAATTTTCATAGCTTCCGG + Intergenic
1090741307 11:129663473-129663495 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1091151550 11:133333522-133333544 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1092128006 12:6088752-6088774 ATCTGAATGTTCATAGCTTGGGG + Intronic
1092508779 12:9130909-9130931 TCTAGAAATTTCATAGTTTTAGG + Intergenic
1093491920 12:19714762-19714784 TCCAGGATTTTTATAGTTTTGGG + Intronic
1093502128 12:19825318-19825340 TCCAGAGTTTTTATAGCCTTGGG - Intergenic
1093677550 12:21961678-21961700 TCCAGTAGTTTCATAGTTTTGGG - Intergenic
1093770579 12:23012997-23013019 TCCAGGATTTTCATAACTTTGGG + Intergenic
1094206589 12:27846697-27846719 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1094253757 12:28398030-28398052 TCCAAAAAGTTGATAGATTTGGG - Intronic
1094734398 12:33218129-33218151 TCCAGGGTATTTATAGCTTTGGG + Intergenic
1094739554 12:33273291-33273313 TCTAGAATTTTTATAGCTATGGG + Intergenic
1095186256 12:39203445-39203467 TCCAGGGTTTTCATAGGTTTAGG - Intergenic
1095610630 12:44123512-44123534 TCCAGGGTTTTTATAGCTTTGGG + Intronic
1095660326 12:44725147-44725169 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1096869430 12:54584091-54584113 TGCAGAATATTCTTTGCTTTTGG - Intronic
1096888192 12:54739096-54739118 TCTAGAATTTTTATAGTTTTGGG + Intergenic
1098402867 12:70092286-70092308 TCCAGAGTTTTCGTAGTTTTAGG - Intergenic
1098789584 12:74804717-74804739 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1099558246 12:84139124-84139146 TCTAGAAGTTTCATAGCTGTAGG - Intergenic
1099646259 12:85360996-85361018 TCTAGAATGTTTATAGTTTGAGG - Intergenic
1099701488 12:86088252-86088274 TCCAGAGTTTTTATAGTTTTAGG - Intronic
1099860600 12:88221156-88221178 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1099865993 12:88281693-88281715 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
1099936081 12:89127322-89127344 TCCAGATTGTTCATGACTGTAGG - Intergenic
1100878413 12:98989220-98989242 TCTAGAAGTTTCATAGTTTTGGG + Intronic
1101250893 12:102934053-102934075 TTCAGTATTTTCATAGTTTTAGG + Intronic
1101464393 12:104932912-104932934 TCTAGAATTTTTATGGCTTTAGG - Intronic
1102107733 12:110340132-110340154 TTCATTTTGTTCATAGCTTTAGG - Intronic
1102322626 12:111950711-111950733 TCCAGGATTTTTATAGTTTTGGG - Intronic
1102527314 12:113521079-113521101 TCTAGAAAGTTCTTTGCTTTGGG + Intergenic
1102916259 12:116755098-116755120 TCTAGAATTTTTATAGTTTTAGG + Intronic
1104147169 12:126046116-126046138 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1104295093 12:127504769-127504791 TGCAGAATGTTCTAAACTTTTGG + Intergenic
1104518451 12:129450315-129450337 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1106486805 13:30179597-30179619 TCCATAATGATCCTAGCTGTAGG + Intergenic
1106856209 13:33856080-33856102 TCCAGGGTTTTTATAGCTTTGGG + Intronic
1107230917 13:38109234-38109256 TCTAGAATGTTTATAGTTTTAGG - Intergenic
1108977952 13:56472923-56472945 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1109057524 13:57570604-57570626 TCCAGGATGTTTATAGTTTGAGG + Intergenic
1109125784 13:58515359-58515381 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1109200709 13:59427732-59427754 TCCAGAATTTTTATACCTTCAGG - Intergenic
1109374888 13:61479554-61479576 TCCAGAATTTTTATAGCTTTAGG + Intergenic
1109409884 13:61948975-61948997 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1109701931 13:66037229-66037251 TTCAGAATGATCCTAGCGTTGGG + Intergenic
1110204873 13:72900629-72900651 TCCAGAATTTTTATAGTTTTGGG - Intronic
1110406645 13:75158338-75158360 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1110482010 13:75989583-75989605 TCCAGAGTTTTTATAGCTTTAGG - Intergenic
1110536145 13:76652863-76652885 TCCAGAGTTTCTATAGCTTTAGG - Intergenic
1111260715 13:85736767-85736789 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1111439867 13:88267233-88267255 TCCAGAATGTTTATTGTTTCAGG + Intergenic
1111576466 13:90160960-90160982 TCCAGGGTTTTTATAGCTTTTGG - Intergenic
1111799826 13:92967930-92967952 TCAAGAATTTTCATTGCTTTTGG - Intergenic
1113037657 13:106069110-106069132 GCTAAAATGTGCATAGCTTTGGG - Intergenic
1113075651 13:106465473-106465495 TACTGAATGTTCATATCTATGGG + Intergenic
1113272598 13:108690853-108690875 TCCACAAATTTCATACCTTTTGG - Intronic
1113993689 14:16049993-16050015 TCTAGTATTTTCATAGTTTTAGG + Intergenic
1114406308 14:22459588-22459610 TCCAGAATCTTCCAAGCTGTAGG - Intergenic
1114469182 14:22947431-22947453 TCAAGGATGTTGAAAGCTTTTGG + Intronic
1114686845 14:24540866-24540888 TCCAGGGTTTTTATAGCTTTAGG - Intergenic
1114797976 14:25738772-25738794 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1116052151 14:39817633-39817655 TCCAGAAGTTTTATAGTTTTAGG + Intergenic
1116088622 14:40275009-40275031 CCTAGAATTGTCATAGCTTTAGG + Intergenic
1116190034 14:41653275-41653297 TCCAGAGTTTTTATAGCTTTGGG + Intronic
1116257506 14:42575584-42575606 TTCAGTATGTTGATAGCTGTGGG - Intergenic
1116266042 14:42691831-42691853 TCCAGGATTTTCATAGCTTGGGG - Intergenic
1116297375 14:43129578-43129600 TCCAGAATTTTTATAGTTTGAGG + Intergenic
1116521928 14:45859469-45859491 TCTAGGGTGTTTATAGCTTTAGG + Intergenic
1116574415 14:46554598-46554620 TCCAGAATTTTTATAGCTTCAGG + Intergenic
1116650992 14:47592765-47592787 TCCAGGGTTTTTATAGCTTTCGG - Intronic
1116773968 14:49158625-49158647 TCTAGAATGTTTATAGTTTCAGG + Intergenic
1117080303 14:52145030-52145052 TCCAGAGTTTTTATAGCTGTAGG + Intergenic
1117641534 14:57804649-57804671 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1118034524 14:61852029-61852051 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1118166027 14:63337454-63337476 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1118489860 14:66248452-66248474 GGCAGGTTGTTCATAGCTTTGGG + Intergenic
1118540569 14:66819199-66819221 TCCAGGGTGTTTATAGTTTTGGG + Intronic
1119190436 14:72678343-72678365 TCAATAATTTTTATAGCTTTGGG - Intronic
1119939985 14:78630247-78630269 TCCAGATTATTTATAACTTTTGG + Intronic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1122004938 14:98695101-98695123 TCCACAATGTTTATAGCTAGAGG + Intergenic
1122262905 14:100533338-100533360 CCCAGAAGGGTCAGAGCTTTGGG - Intergenic
1124084905 15:26539343-26539365 TCTAGAAGCTTTATAGCTTTAGG - Intergenic
1125316242 15:38434898-38434920 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1125984090 15:44032231-44032253 TCCAGGGTTTTCATAGTTTTGGG - Intronic
1126226340 15:46274513-46274535 TCCAGAATCTTCACAGATATGGG - Intergenic
1126520385 15:49586418-49586440 TCCAGGGTTTTCATAGTTTTGGG - Intronic
1126981104 15:54244089-54244111 TCTAGAGTGTTTATAGTTTTGGG + Intronic
1128858785 15:71046797-71046819 TCCAGAATTTTTATAGTTTGAGG + Intronic
1129013210 15:72441799-72441821 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1129135622 15:73547805-73547827 TCCAGCATTTTTATAGCGTTTGG - Intronic
1129529094 15:76248093-76248115 TCCAAAATGTTTTTAGCTGTTGG - Intronic
1129585176 15:76855305-76855327 TCCAGGATTTTTATAGTTTTGGG - Intronic
1129954169 15:79619091-79619113 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1130786113 15:87098636-87098658 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1131959892 15:97778552-97778574 TCCAGGATTTTCATAGTTTTAGG - Intergenic
1132033809 15:98462503-98462525 TCCAGAATTTTTATAGTTTGAGG - Intronic
1132245231 15:100290878-100290900 TCCAGAGTTTTTATAGTTTTAGG - Intronic
1136641976 16:31573908-31573930 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1136663406 16:31785746-31785768 TCCAGAATTTTTATAGTTTCAGG + Intronic
1136715165 16:32274412-32274434 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1136729422 16:32394625-32394647 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1136752750 16:32655319-32655341 TCCAGAATTTTTATAGTTTGAGG + Intergenic
1136821840 16:33325126-33325148 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1136828403 16:33381665-33381687 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1136833469 16:33480437-33480459 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1137303504 16:47177672-47177694 TCCAGAATATTCAGGGCATTGGG - Intronic
1137759112 16:50926376-50926398 TCCAATAAGTTCATGGCTTTGGG - Intergenic
1137969453 16:52969711-52969733 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1137998843 16:53252431-53252453 TCCAGAATTTTTATAGTTTCAGG - Intronic
1138917146 16:61479391-61479413 TCTAGTAATTTCATAGCTTTAGG - Intergenic
1139460137 16:67115500-67115522 TCCAGAATATTCAGGGCCTTTGG + Intronic
1140004201 16:71059257-71059279 TCCAGGATTTTTATAGTTTTAGG + Intronic
1202993941 16_KI270728v1_random:38021-38043 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1202996971 16_KI270728v1_random:122668-122690 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1203011447 16_KI270728v1_random:244084-244106 TCCAGAATTTTTATAGTTTGAGG + Intergenic
1203023658 16_KI270728v1_random:435010-435032 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1203054887 16_KI270728v1_random:915357-915379 TCCAGAATTTTTATAGTTTGAGG + Intergenic
1143064504 17:4234942-4234964 TTCAGAATTTTAATAGGTTTGGG - Intronic
1144407709 17:14968406-14968428 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1144616179 17:16775816-16775838 TCCAGGATTTTTATAGTTTTGGG + Intronic
1146198555 17:30834250-30834272 TCCAGAATATTACTAGGTTTTGG - Exonic
1146316168 17:31808949-31808971 TACAGAATTTTCAAAGCTTCCGG + Intergenic
1146602545 17:34230780-34230802 TCCAGAGTTTTTATAGTTTTTGG - Intergenic
1147426686 17:40349056-40349078 CTCAGAATCTTCACAGCTTTGGG + Intronic
1148066300 17:44872774-44872796 TGCAGAATGTTCCCAGCTCTGGG - Intronic
1149039986 17:52176345-52176367 TCCAAAATGTTCATATATTCAGG + Intergenic
1149110915 17:53028922-53028944 TTTAGAATTTTCATAGTTTTAGG + Intergenic
1149163005 17:53717506-53717528 TCCAGAGTTTTCATAGTTTTAGG + Intergenic
1149176701 17:53880541-53880563 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
1149198146 17:54148636-54148658 TCCAGGGTGTTTATAGTTTTAGG + Intergenic
1149395304 17:56235465-56235487 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1150092967 17:62345904-62345926 TCCAGAATTTTTATGGATTTGGG + Intergenic
1150459856 17:65340874-65340896 TCCAGAATTTTTATAGTTTTAGG - Intergenic
1150598627 17:66629892-66629914 TACAGTCTGTTCATAGCATTGGG + Intronic
1150911465 17:69391953-69391975 TCAAGAATGCTCATAACCTTCGG + Intergenic
1150940091 17:69683460-69683482 TCCAGAGTTTTTATAGTTTTAGG + Intergenic
1151895824 17:76980287-76980309 TCTAGAAGTTTCATAGTTTTAGG - Intergenic
1152460221 17:80438569-80438591 TCAAGAATATTCTTAGCTCTGGG - Intergenic
1152989769 18:352245-352267 TACAGAATGTTTACAGGTTTAGG + Intronic
1153175907 18:2372869-2372891 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1153277824 18:3385244-3385266 TTCAAACTGTTCATTGCTTTAGG - Intergenic
1153785808 18:8534114-8534136 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
1154270976 18:12919317-12919339 TCCAGAATTTTTATAGTTTCAGG - Intronic
1155105868 18:22665416-22665438 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1156238059 18:35223243-35223265 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1157047444 18:44119547-44119569 CCCAGAATGTAAATACCTTTAGG - Intergenic
1157729706 18:49992855-49992877 TCCAGAAAGTTCAGAGCTAGTGG - Intronic
1158473650 18:57760548-57760570 GCCAGAATGTGCATTACTTTTGG - Intronic
1158667427 18:59445149-59445171 TCTAGGATTTTCATAGTTTTGGG + Intronic
1158830246 18:61269368-61269390 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1159158237 18:64610385-64610407 TCCACAATGTACATAGTTCTAGG - Intergenic
1163231274 19:16004328-16004350 TCCAGAGTTTTCATAGTTTTGGG - Intergenic
1164088379 19:21925071-21925093 TCCAGAATGTGCAAAGATATTGG - Intergenic
1164191456 19:22921086-22921108 TCCAGAATGTGCAAAGATATTGG - Intergenic
1165965386 19:39573873-39573895 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1165967978 19:39600409-39600431 TCCAGGATGTTTATAGTTTTGGG - Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
1167887187 19:52510096-52510118 TACAGAATTTCCATTGCTTTTGG + Intronic
1168079244 19:53997470-53997492 TGAAGAATGTTCATAGCCTGTGG - Intronic
924984514 2:257343-257365 TCCAGAGTTTTTACAGCTTTAGG + Intronic
925110693 2:1333817-1333839 TCCAGAATTTTTATAGTTTCAGG - Intronic
925193745 2:1907181-1907203 TCCAGAATTCTCATAGCATTTGG - Intronic
925417984 2:3686091-3686113 TCTAGAATGTTCATAGTTTTAGG + Intronic
925419445 2:3700110-3700132 TCCAGGGTGTTTATAGTTTTGGG + Intronic
926498483 2:13621486-13621508 TCCAGAATTTTTATAGCTTGAGG - Intergenic
926836145 2:17023331-17023353 TCCAGAGTGTTCATAGTTTTAGG + Intergenic
927330551 2:21858079-21858101 TCCAGTACTTTCATAGGTTTAGG + Intergenic
928461720 2:31480434-31480456 TCCAGAGTTTTCATAGTTTTGGG + Intergenic
928814733 2:35279194-35279216 TCCAGAGTTTTTATAACTTTAGG + Intergenic
928916610 2:36478661-36478683 TCCAGACAGTTCATAGAGTTTGG - Intronic
929469717 2:42179550-42179572 TCCATGATGTTTATAGCTTATGG + Intronic
929782377 2:44965400-44965422 TCCCCAGTGTTCATAGCTTATGG + Intergenic
930127874 2:47817014-47817036 TCCAGAACATTCATAGCTAGAGG - Intronic
930302593 2:49635886-49635908 TCCAGGATTTTTATAGTTTTAGG - Intergenic
930440449 2:51397753-51397775 TCTAGAATTTTTATAGCTTCAGG - Intergenic
930557620 2:52919117-52919139 TGCAGGATTTTCATGGCTTTAGG - Intergenic
930563730 2:52993731-52993753 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
930586403 2:53272313-53272335 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
930930752 2:56879050-56879072 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
931508544 2:62961038-62961060 TCCAAAATGAGTATAGCTTTAGG + Intronic
931889615 2:66656923-66656945 TCCAGGATTTTTATAGTTTTGGG + Intergenic
931925654 2:67069495-67069517 TCCAGGGTGTTTATAGTTTTGGG - Intergenic
931966205 2:67537759-67537781 TCCAGAATTTTTAAAGTTTTAGG + Intergenic
932022712 2:68103914-68103936 GCCAGAATTTTCCTTGCTTTAGG - Intronic
933080828 2:77983061-77983083 TCCAGAGTTTTTATAGCTTTAGG - Intergenic
934185722 2:89672662-89672684 TCTAGAATTTTTATAGTTTTAGG + Intergenic
934316719 2:91927967-91927989 TCTAGAATTTTTATAGTTTTAGG - Intergenic
934485433 2:94704387-94704409 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
934512600 2:94958118-94958140 TTCTGAATGTTTATAGTTTTGGG - Intergenic
935464877 2:103384466-103384488 TCCAGGCTTTTCTTAGCTTTTGG + Intergenic
935750468 2:106228654-106228676 TCAAGTATGATGATAGCTTTAGG + Intergenic
936442728 2:112569166-112569188 TATAGAATGTCCATAGATTTGGG + Intronic
937178987 2:119972192-119972214 ACCAGAATGTTCATAGGGATTGG + Intronic
937540817 2:122950589-122950611 TCCAGGAATTTCATAGTTTTGGG + Intergenic
937586588 2:123558863-123558885 TCCAGAGTTTTTATAGCATTGGG + Intergenic
937699146 2:124844122-124844144 TCTAGAATCTTTATGGCTTTAGG + Intronic
937752476 2:125493429-125493451 TCCAGTAGTTTCATAGTTTTGGG + Intergenic
937972018 2:127557873-127557895 TCTAGAATTTTTATAGTTTTAGG - Intronic
938027176 2:127959834-127959856 TCCAAAATTTTTATAACTTTGGG - Intronic
939205121 2:139092277-139092299 TCCAGGGTGTTTATAGTTTTAGG - Intergenic
939512134 2:143120529-143120551 TCTAGAATTTTTATAGTTTTGGG + Intronic
939747810 2:145999206-145999228 TCTAGGATTTTCATAGTTTTGGG - Intergenic
940392917 2:153153502-153153524 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
940456519 2:153908502-153908524 TCCAGAGTTTTTATAGTTTTGGG + Intronic
940707181 2:157119999-157120021 TCTAGAATTTTCATAGTTTTAGG + Intergenic
940708991 2:157139449-157139471 TCTAGAATTTTCATAGTTTCAGG + Intergenic
941034892 2:160557718-160557740 TCCAGCATTTTTATAGTTTTGGG - Intergenic
941552668 2:166936524-166936546 TCTAGGGTTTTCATAGCTTTAGG + Intronic
941583396 2:167327834-167327856 TTCAGAATGTTGTTAGCTGTGGG + Intergenic
941910299 2:170757976-170757998 TCCAGAAGTTTCATATGTTTAGG - Intergenic
942828359 2:180208245-180208267 TCCAGGATTTTTATAGTTTTAGG + Intergenic
943013688 2:182484393-182484415 TCCAGAGTTTTTATAGTTTTGGG - Intronic
943092073 2:183387561-183387583 TCCAGGGTGTTTATAGTTTTGGG + Intergenic
943149541 2:184094531-184094553 TCTAGAATGTTTATTGTTTTAGG + Intergenic
943152563 2:184133161-184133183 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
943281241 2:185936053-185936075 TCCAGTACTTTCATAGTTTTGGG + Intergenic
943433161 2:187829239-187829261 TCCAGAATTTTTATAATTTTGGG - Intergenic
943943906 2:194033922-194033944 TCTAGAATTTTCATGGTTTTAGG - Intergenic
944330792 2:198464124-198464146 TCCAGAGTTTTTATAGTTTTGGG + Intronic
944431574 2:199639449-199639471 TCTAGAATTTTTATAGCTTCAGG + Intergenic
944955955 2:204809387-204809409 TCCAGGGTTTTTATAGCTTTTGG + Intronic
945315304 2:208364339-208364361 TCCAGAAGTTTTATTGCTTTGGG + Intronic
945334615 2:208578062-208578084 TCCAGGATTTTTATAGTTTTGGG + Intronic
945459670 2:210090859-210090881 TGCAGAATGTTTATAGATATAGG - Intronic
945729615 2:213517833-213517855 TCTAGAATTTTCATAGTTTTAGG - Intronic
947249987 2:228091296-228091318 TCTAGAATTTTCATAGTTTGAGG - Intronic
947352356 2:229259532-229259554 TCCAGAAGTTTTATAACTTTAGG + Intronic
947456638 2:230260554-230260576 TCCAGAATTTTTATAGTTTCAGG + Intronic
948017874 2:234704767-234704789 TTCAGAGAATTCATAGCTTTTGG - Intergenic
948065018 2:235071511-235071533 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1168941629 20:1717719-1717741 TCCAGAATTTTTATAGTTCTAGG - Intergenic
1169517031 20:6328462-6328484 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1170142610 20:13140023-13140045 TCCAGAAAGTACACAGCTTTGGG - Intronic
1170245363 20:14216117-14216139 TCTAGAATGTTAATAGTTTCAGG + Intronic
1170856099 20:20056815-20056837 TCAAGAATGTTCATCAATTTTGG + Intronic
1170987400 20:21271236-21271258 TCCAGAGTGTTTATAGATTTAGG + Intergenic
1171166004 20:22972088-22972110 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1171286984 20:23948334-23948356 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1171325747 20:24290882-24290904 TCCTGAATGTTCATGTCTTTTGG - Intergenic
1171762223 20:29216048-29216070 TCCAGAGTTTTCATAGTTTTAGG - Intergenic
1172236533 20:33379644-33379666 GTCAGAATGTTAATAGTTTTCGG - Exonic
1173841611 20:46161044-46161066 TCCAGAATGTCCCTAGGTTCTGG - Intergenic
1174605102 20:51755665-51755687 TCAAGAATGTTCATAGCAGCCGG + Intronic
1174652617 20:52140817-52140839 TCTAGGATGTTCATAGCTAGAGG + Intronic
1175048178 20:56126921-56126943 TCCTGCATGTTTATGGCTTTGGG - Intergenic
1176902159 21:14455357-14455379 TCCAGAATGTTCTGATCTTGTGG + Intergenic
1177043551 21:16142647-16142669 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1177564041 21:22795628-22795650 TCCAGAATTTTTATAGTTTAAGG - Intergenic
1177924296 21:27194652-27194674 TCCAGGGTGTTTATAGTTTTGGG - Intergenic
1178454981 21:32740626-32740648 TCTAGAAGTTTCATAGTTTTAGG - Intronic
1179083742 21:38197894-38197916 TCCAGAATTTTTATAGTTTCAGG + Intronic
1179300858 21:40109030-40109052 TCCAGAGTGTTTTTAGCTTTAGG - Intronic
1179380445 21:40894409-40894431 TCCAAAATGTCAATATCTTTTGG + Intergenic
1180164229 21:46012809-46012831 TGTACAATGTTCATAGCTATGGG - Intergenic
1180313577 22:11257520-11257542 TCTAGTATTTTCATAGTTTTAGG - Intergenic
1180543054 22:16470435-16470457 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1182758839 22:32705165-32705187 TCCAGGATTTTTATAGTTTTGGG + Intronic
1183574461 22:38678474-38678496 TGCAGAGTGTTCAGAACTTTGGG - Intergenic
1184908370 22:47508273-47508295 TCCAGAATTTTTATGGGTTTTGG - Intergenic
949149826 3:753152-753174 TCCAGTATTTTTATAGTTTTGGG + Intergenic
949176812 3:1073492-1073514 TCCAGAATGCTGATTGTTTTGGG + Intergenic
949316632 3:2763596-2763618 TCCAGAATTTTTATAGTTTTGGG + Intronic
949346690 3:3083599-3083621 TCCAGAAGGTACATAGCCCTTGG - Intronic
949667871 3:6362214-6362236 TCCAGAATTTTTATAGTTTGAGG - Intergenic
950947770 3:16967874-16967896 TCCAGAATTTTTATAGTTTTAGG + Intronic
951060218 3:18197868-18197890 TCTAGAATTTTCATAGTTTGAGG + Intronic
951253877 3:20426803-20426825 TCCAAAATTTTTATAGTTTTGGG + Intergenic
951305227 3:21052204-21052226 TCCAGGTTGTTCATAGTTTTAGG - Intergenic
951468203 3:23025376-23025398 TCTAGAATTTTTATAGTTTTAGG - Intergenic
951517992 3:23583040-23583062 TCCAGGGTTTTCATAGTTTTAGG + Intronic
951572024 3:24074187-24074209 TCCAGAATTTTTATAGTTTCAGG + Intergenic
952004845 3:28831601-28831623 TCCAGGATTTTTATAGTTTTGGG - Intergenic
952445087 3:33373390-33373412 TCCAGAATGTTCATAGCTTTGGG - Intronic
952570241 3:34707095-34707117 TCCAGAATTTTAATAATTTTGGG - Intergenic
952695685 3:36263125-36263147 TCTAGAGTTTTTATAGCTTTAGG + Intergenic
953509916 3:43525221-43525243 TCCTGCATCTTCATAGCTCTGGG + Intronic
953630131 3:44607961-44607983 TCTAGAATTTTCATTGTTTTAGG - Intronic
955414659 3:58680928-58680950 TCCATCATGATCATAGCTATGGG + Intergenic
956047058 3:65206981-65207003 TCCAGAATTTTCATATATTAGGG + Intergenic
957428040 3:80065196-80065218 TCTAGAATTTTTATAGTTTTAGG - Intergenic
957505760 3:81118477-81118499 TCCAGAATTTTCATGGTTTCAGG - Intergenic
957608390 3:82434055-82434077 TCCAGAGTTTTCATAGTTTTGGG + Intergenic
957763187 3:84586608-84586630 TCCAGAATTTTTATAGTTTTGGG + Intergenic
957852812 3:85831934-85831956 TCTAGAATTTTTATAGTTTTAGG + Intronic
957855481 3:85870922-85870944 TCCAGAGTTTTTATAGTTTTGGG - Intronic
958495010 3:94833842-94833864 TCCAGGGTGTTTATAGTTTTGGG - Intergenic
958557172 3:95694879-95694901 TCCAGGGTTTTCATAGTTTTTGG + Intergenic
958741324 3:98076802-98076824 TCTAGAATGTTTATAGTTTCAGG + Intergenic
958769855 3:98413189-98413211 TCCAGAATTTTTATAGTTTTGGG - Intergenic
958843345 3:99235587-99235609 TCCAGAGTTTTCATAGTATTGGG + Intergenic
958854528 3:99368596-99368618 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
959104411 3:102050121-102050143 TCCAGGGTCTTTATAGCTTTGGG + Intergenic
959197236 3:103200068-103200090 TCCAGATGGTTTATAGCTGTTGG - Intergenic
959207391 3:103327517-103327539 TCCAGAATTTTTATAGTTTGAGG - Intergenic
959290256 3:104464951-104464973 TCCAGAGTTTTCATGGTTTTAGG + Intergenic
959325256 3:104928875-104928897 TCCAGAATTTTTATAGTTTCAGG + Intergenic
959326831 3:104947429-104947451 TCCAGAGTTTTTATAGTTTTTGG + Intergenic
959654642 3:108788568-108788590 TCCAGTATTTTTATAGCTTCAGG - Intergenic
959997058 3:112691810-112691832 TCCAGGGTTTTCATAGTTTTAGG + Intergenic
960314439 3:116159135-116159157 TCAAGGATTTTTATAGCTTTAGG - Intronic
960500460 3:118431479-118431501 TCCAGGATTTTTATAGTTTTAGG + Intergenic
960688542 3:120318773-120318795 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
960721699 3:120630654-120630676 TCCAGAGTTTTTATAGTTTTGGG - Intronic
961174667 3:124824414-124824436 TTCAGAAGTTTTATAGCTTTAGG - Intronic
961590604 3:127977938-127977960 TCCAGAGTTTTTATAGTTTTAGG + Intronic
961645453 3:128390508-128390530 CCCAGAATGTTAGTTGCTTTGGG + Intronic
962174817 3:133141934-133141956 TCCAAAATGTTCATTGTATTAGG - Intronic
962176018 3:133155951-133155973 TACAGAGTTTTTATAGCTTTAGG + Intronic
962211689 3:133484697-133484719 TCTAGTACTTTCATAGCTTTAGG + Intergenic
962981556 3:140495574-140495596 TCTAGAGTTTTCATAGTTTTGGG + Intronic
963053868 3:141167163-141167185 TCCAGAAATTTTATAGCTTTAGG + Intergenic
963057566 3:141199476-141199498 TCCAGGATTTTTATAGTTTTGGG - Intergenic
963401057 3:144800339-144800361 TCCAGAGTTTTTATAGCTTTAGG + Intergenic
963449893 3:145465164-145465186 TCCAGGGTTTTCATAGTTTTAGG - Intergenic
963579844 3:147111622-147111644 TCCAGGATTTTTATAGTTTTGGG + Intergenic
963847541 3:150174727-150174749 TCTAGAATTTTTATAGCTTCAGG - Intergenic
964137985 3:153367070-153367092 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
964430111 3:156596683-156596705 TCTAGAATTTTTATAGTTTTAGG - Intergenic
964915925 3:161841810-161841832 TCTAGAATGTTTATAGTTTCAGG + Intergenic
964995791 3:162878708-162878730 TCCAGAACATTGATAACTTTGGG - Intergenic
965067600 3:163872177-163872199 TCCAGAATATTACTAACTTTAGG - Intergenic
965123212 3:164590476-164590498 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
965223221 3:165954252-165954274 TCCAGAATTTTTATAGTTTCAGG - Intergenic
965326210 3:167307843-167307865 TCCAGGGTTTTCATAGTTTTGGG - Intronic
965932385 3:174060834-174060856 TCTAGAAAGATAATAGCTTTAGG - Intronic
966583250 3:181592011-181592033 TCCAGAATTTTTATAGTTTGAGG + Intergenic
966686590 3:182702599-182702621 TCTAGAATTTTCATAGTTTCAGG + Intergenic
967508223 3:190278492-190278514 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
967637861 3:191825172-191825194 TCCAGAGTTTTTACAGCTTTAGG - Intergenic
967660149 3:192097420-192097442 TCCAGGATATTTATAGTTTTAGG - Intergenic
970012665 4:11477000-11477022 TCCAGGATTTTTATAGTTTTGGG - Intergenic
970855064 4:20641659-20641681 TCCCGAATTTTTATAGTTTTAGG + Intergenic
971080499 4:23204822-23204844 TCCAGAATCTTTATGGGTTTGGG + Intergenic
971707200 4:30060412-30060434 TCTAGAATGTTCTAATCTTTAGG - Intergenic
972834175 4:42848841-42848863 TCTAGAATTTTCATAGTTTGAGG + Intergenic
972905463 4:43741471-43741493 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
972933067 4:44099097-44099119 TCCAGAGTTTTTATAGTTTTAGG + Intergenic
972955658 4:44387746-44387768 TCCAGGATTTTTATAGTTTTGGG - Intronic
973012261 4:45091806-45091828 TCCAGAATTTTTATACTTTTAGG - Intergenic
973196015 4:47442816-47442838 TCTAGAATTTTTATAGTTTTAGG - Intergenic
973850995 4:54961518-54961540 TCCATAGTGATAATAGCTTTTGG - Intergenic
974306660 4:60151521-60151543 TCTAGAATATTTATGGCTTTAGG + Intergenic
974535164 4:63165159-63165181 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
975071461 4:70144864-70144886 TCCAGAATTTTTATAGTTTCAGG - Intronic
975194905 4:71512745-71512767 TCCAGTATTTTTATAGTTTTGGG + Intronic
975239870 4:72044311-72044333 TCCAGGATTTTTATAGTTTTAGG + Intronic
975247197 4:72133112-72133134 TCCAGAGTTTTCATAGTTTTGGG + Intronic
975357215 4:73421901-73421923 TCTAGAATTTTTATAGTTTTAGG - Intergenic
975670596 4:76776710-76776732 TCTAGAATTTTTATGGCTTTAGG + Intronic
975904349 4:79191793-79191815 TCCAGGATTTTTATAGTTTTGGG + Intergenic
976001734 4:80382188-80382210 TCCAGAGTTTTTATAGTTTTTGG - Intronic
976559658 4:86486977-86486999 GACAGAATGTTCATCACTTTGGG - Intronic
976583938 4:86773653-86773675 TCCAAAATGTTAACAGTTTTGGG - Intronic
976930433 4:90560277-90560299 TCTAGGATGTTTAGAGCTTTGGG - Intronic
977001983 4:91516319-91516341 TCCAGAGTTTTTATAGGTTTAGG + Intronic
977385328 4:96332065-96332087 TCTAGAGTTTTCATAGTTTTGGG - Intergenic
977484337 4:97623144-97623166 TCCAGAGTTTTTATAGTTTTAGG - Intronic
977492495 4:97732296-97732318 TCCAGAATGCTTATAGTTTCAGG + Intronic
977511037 4:97963275-97963297 TCATGAATGTTAATAGTTTTTGG - Intronic
977596965 4:98893809-98893831 TCCAGAATGCTCAATCCTTTCGG + Intronic
978063068 4:104362731-104362753 TCTAGAATTTTTATAGTTTTAGG - Intergenic
978158099 4:105512370-105512392 TCTAGAATTTTCATAGTTTCAGG + Intergenic
978238028 4:106483806-106483828 TCTAGAATTTTTATAGCTTTGGG + Intergenic
978286978 4:107090807-107090829 TCCAGAGTTTTTATAGTTTTTGG - Intronic
978417898 4:108497750-108497772 TCTAGTATATTCATAGTTTTGGG - Intergenic
978538659 4:109791552-109791574 TCCAGGGTTTTCATAGTTTTGGG + Intronic
978683322 4:111409905-111409927 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
978999033 4:115194863-115194885 TCTAGAATTTTTATAGCTTCAGG + Intergenic
979012080 4:115385081-115385103 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
979191022 4:117858783-117858805 TCCAGGATTTTTATAGTTTTGGG - Intergenic
979435140 4:120679355-120679377 TCCAGAATTTTTATAACTTGGGG - Intergenic
979509857 4:121540109-121540131 TCCAGAATTTTTATAGTTTCAGG + Intergenic
979565381 4:122148847-122148869 TCCAGGATTTTTATAGTTTTAGG - Intergenic
979984879 4:127301412-127301434 TCCAGAATTTTTATGGTTTTAGG - Intergenic
980065645 4:128185798-128185820 TCTAGTAATTTCATAGCTTTGGG + Intronic
980398936 4:132254380-132254402 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
980516916 4:133876116-133876138 TCCAGAGTCTTCATAGTGTTGGG + Intergenic
980524899 4:133977025-133977047 TCTAGAATTTTTATAGTTTTGGG + Intergenic
980670345 4:135996261-135996283 TCAAGTATTTTCATAGTTTTAGG - Intergenic
980769143 4:137349450-137349472 TCCAGAAGTTTTATAGCTTCAGG - Intergenic
981147409 4:141341168-141341190 TTCTGATTGTTCATATCTTTGGG - Intergenic
981605967 4:146540854-146540876 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
981760339 4:148187831-148187853 TCTAGAATTTTCATAGTTTCAGG + Intronic
981850448 4:149223448-149223470 TCCAGGATTTTTATAGTTTTGGG - Intergenic
982279711 4:153670449-153670471 TCTAGAACTTTCATAGCTTCAGG + Intergenic
982531587 4:156551432-156551454 TCTAGAATTTTCATAGTTTCGGG + Intergenic
983134617 4:164065320-164065342 TCCAGGATTTTTATAGTTTTGGG - Intronic
983233029 4:165148563-165148585 TCCAGAGTTTTAATAGTTTTGGG + Intronic
983233040 4:165148745-165148767 TCCAGAGTTTTAATAGTTTTGGG + Intronic
983290189 4:165792890-165792912 TCCAGGACTTTCATAGCTATAGG - Intergenic
983683627 4:170381493-170381515 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
983755748 4:171333151-171333173 TCTAGAATTTTTATAGGTTTAGG - Intergenic
983876976 4:172888298-172888320 TCCATAATTTTTATAGCTTAAGG + Intronic
983899459 4:173118233-173118255 TCCAGGATTTTCATAATTTTGGG - Intergenic
984144037 4:176039390-176039412 TCCAGGATGTTCACAGTTTTGGG + Intergenic
984474688 4:180221032-180221054 TCCAGAATGTTCATAGTTTCAGG + Intergenic
984516758 4:180750848-180750870 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
985301019 4:188489644-188489666 TCCAGAATTTTTATAGTTTGAGG + Intergenic
985860420 5:2466271-2466293 TCCAGCATTTTCGTAGCTATAGG - Intergenic
986419071 5:7558794-7558816 TCCAGGGTTTTCATAGTTTTGGG + Intronic
986421664 5:7590708-7590730 ACCATAATGTTCATTACTTTTGG - Intronic
986753978 5:10816963-10816985 TCCAGACTTTTTATAGTTTTGGG - Intergenic
986822200 5:11480120-11480142 TCCAGGATTTTTATAGCTTGGGG + Intronic
986870639 5:12041358-12041380 TCTAGAATTTTTATAGTTTTAGG - Intergenic
986932802 5:12848138-12848160 TCTAGCAGTTTCATAGCTTTGGG - Intergenic
986945446 5:13013021-13013043 ACCGGAGTTTTCATAGCTTTGGG + Intergenic
987430368 5:17825493-17825515 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
987531058 5:19119891-19119913 TCCAGGATTTTTATAGTTTTGGG - Intergenic
987553109 5:19409612-19409634 TCCAGAGTTCTCATAGTTTTAGG + Intergenic
988323647 5:29733971-29733993 TCCAGGATTTTTATAGTTTTGGG - Intergenic
988403311 5:30791260-30791282 TCCAGAATATTCTGAGGTTTGGG + Intergenic
988405328 5:30817014-30817036 TCCAGAATTCTTATAGCTTGAGG + Intergenic
988650770 5:33148198-33148220 TCCGGAATGTCCTTAGCTTCTGG + Intergenic
988837333 5:35046208-35046230 TCCACAATGTTCAGAGGTTGGGG + Intronic
988894937 5:35662539-35662561 TCCAGGGTTTTTATAGCTTTGGG + Intronic
989020893 5:37006471-37006493 TCCTCAATGTACACAGCTTTTGG - Exonic
989298973 5:39865803-39865825 TCCAGAATTTTTATAGTTTTAGG + Intergenic
989689698 5:44126355-44126377 TCAAGAATTTTCATGGTTTTAGG - Intergenic
989693746 5:44175049-44175071 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
990206571 5:53435723-53435745 TCCACAGTGTTCATATCATTAGG + Intergenic
990336835 5:54782231-54782253 TCCAGAATTTTTATAGTTTTGGG - Intergenic
990348636 5:54893451-54893473 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
991238203 5:64423875-64423897 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
992056231 5:72994015-72994037 TCCAGAGTTTTTATAGTTTTGGG - Intronic
992339669 5:75809942-75809964 TCCAGAATTTTTATAGTTTCAGG + Intergenic
993311726 5:86340581-86340603 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
993405409 5:87505970-87505992 TGCATAATGTGCATAGCTGTGGG - Intergenic
993540139 5:89139086-89139108 TCCAGAATGTTTATGGTTTTAGG + Intergenic
993801490 5:92348575-92348597 TCCAGAGTTTTTATAGTTTTCGG + Intergenic
994309755 5:98255332-98255354 TCCAGAGTTTTTATAGTTTTAGG + Intergenic
994326465 5:98452208-98452230 TCCAGTAGTTTCATAGTTTTAGG - Intergenic
994473102 5:100234917-100234939 TCCAGGTTGTTTATAGTTTTGGG + Intergenic
994620792 5:102159499-102159521 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
994626075 5:102220742-102220764 TCCAGAATTTTTATAGTTTCAGG + Intergenic
994953773 5:106499911-106499933 TCTAGAATTTTTATGGCTTTAGG + Intergenic
994957456 5:106551607-106551629 TCCAGGATTTTTATAGTTTTGGG - Intergenic
995279187 5:110314143-110314165 TCTAGTAGTTTCATAGCTTTAGG - Intronic
995300646 5:110576914-110576936 CCCAGGATTTTCATAGTTTTGGG - Intronic
995365865 5:111359694-111359716 TCCAGAGTTTTTATAGTTTTGGG + Intronic
995427049 5:112036893-112036915 TCCAGGGTTTTCATAGTTTTAGG + Intergenic
995472598 5:112518740-112518762 TCTAGAATTTTTATAGCTTCAGG + Intergenic
995633155 5:114155992-114156014 TCCAGCATTTTTATAGTTTTGGG + Intergenic
995819296 5:116209434-116209456 TACAGAATATTCTAAGCTTTTGG - Intronic
996008595 5:118454694-118454716 TCTAGGATGTTTATTGCTTTAGG + Intergenic
996032366 5:118720249-118720271 TCTAGAATTTTTATAGTTTTAGG - Intergenic
996245484 5:121258792-121258814 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
996568624 5:124908195-124908217 CCCAGATTCTTCATTGCTTTGGG + Intergenic
996953746 5:129158996-129159018 TCCAGAGTTTTCATAGTTTGGGG + Intergenic
997181808 5:131836981-131837003 TCCAGGATTTTCATAGTTTTGGG + Intronic
997397881 5:133579122-133579144 TCCAGTATGACCATTGCTTTTGG - Intronic
997638228 5:135430736-135430758 TGCCTAATGTGCATAGCTTTGGG - Intergenic
997765105 5:136495173-136495195 TCTAGAATGTTTATAGTTTCAGG + Intergenic
998051119 5:139036265-139036287 TCCAGGGTTTTCATAGTTTTAGG + Intronic
998603541 5:143609774-143609796 TCTAGAATTTTTATAGCTTCAGG - Intergenic
998631658 5:143905263-143905285 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
998776141 5:145605284-145605306 TCCAGGGTTTTTATAGCTTTAGG + Intronic
999052578 5:148539254-148539276 TCCAGAGTTTTTATAGTTTTGGG - Intronic
999352270 5:150885027-150885049 TCCAGAATGTTTATAGTTTTGGG + Intronic
1000570114 5:162901425-162901447 TCTAGAGTTTTCATAGTTTTAGG - Intergenic
1000615972 5:163427159-163427181 TTCAGAATTTTTATAGCTTCAGG - Intergenic
1002258259 5:177976069-177976091 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1002848994 6:975073-975095 TCTAGAATGTTTATAGTTTCAGG + Intergenic
1002880726 6:1249927-1249949 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1004063654 6:12222177-12222199 TCCAGATTTTTCATGGCGTTGGG + Intergenic
1004064005 6:12225300-12225322 TCCAGAAAGATCATCTCTTTAGG + Intergenic
1004805392 6:19198725-19198747 TCCAGGATTTTTATAGCTGTGGG + Intergenic
1005400510 6:25428123-25428145 TCCAGAAGTTTTACAGCTTTAGG + Intronic
1005760852 6:28966738-28966760 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1005877935 6:30028488-30028510 CCCAGTAGGTTCATAGTTTTGGG + Intergenic
1005909801 6:30298733-30298755 TCTAGTATTTTCATAGTTTTAGG + Intergenic
1006203382 6:32317337-32317359 TCCAGGGTTTTTATAGCTTTGGG - Intronic
1007047740 6:38794822-38794844 TTTAGATTGTTTATAGCTTTTGG + Intronic
1008288265 6:49681105-49681127 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1008331964 6:50256265-50256287 TCCAGAGTTTTTATAGCTTTGGG + Intergenic
1008374270 6:50773554-50773576 TCCAGTATCTTCTTAGCTATTGG - Intergenic
1008529331 6:52441246-52441268 TCCAGGGTGTTTATAGTTTTGGG + Intronic
1008599196 6:53073073-53073095 TACAGAATGTTAATAGATTTTGG + Intronic
1008771631 6:54985830-54985852 TCCAGAGTTTTTATAGCTCTGGG - Intergenic
1008801563 6:55374737-55374759 TCTAGGATTTTCATAGTTTTGGG + Intronic
1008957317 6:57230030-57230052 TTCAGAATGTTCAAAGATGTGGG + Intergenic
1009468740 6:64005580-64005602 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1009710062 6:67306870-67306892 TCTAGAATTTTCATAGATTCAGG + Intergenic
1009764131 6:68047341-68047363 TCCAGAATTTTTATAGTTTTGGG + Intergenic
1009912145 6:69943518-69943540 CCCAGAAGATTCATAGTTTTGGG + Intronic
1010081134 6:71864433-71864455 TCCAGTAGTTTCATAGTTTTGGG + Intergenic
1010140124 6:72604025-72604047 TCTAGTATTTTCATAGTTTTGGG + Intergenic
1010296322 6:74201317-74201339 TCCAGTAATTTCATAGTTTTAGG + Intergenic
1010299674 6:74245070-74245092 TCAAGAATTTTTATAGATTTAGG + Intergenic
1010605547 6:77885780-77885802 TCCAGTATGTTGTTAGCTGTGGG + Intronic
1010645114 6:78378346-78378368 TGCAGAATTTTCATAGTTTATGG - Intergenic
1010744554 6:79546361-79546383 TAGAGAATGTTCTCAGCTTTGGG - Intergenic
1010954995 6:82080224-82080246 TCCAGAATTTTTATAGTTTGAGG - Intergenic
1011105232 6:83772400-83772422 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1011307618 6:85946056-85946078 TGCAGAATGTTCAGAGAGTTTGG + Intergenic
1011327546 6:86166425-86166447 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1011328667 6:86179278-86179300 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1011392745 6:86872506-86872528 TCCAGGGTTTTCATAGTTTTGGG - Intergenic
1011500882 6:87988411-87988433 TCCAGGGTTTTTATAGCTTTAGG - Intergenic
1011671664 6:89689257-89689279 TCCAGAAACTTGAGAGCTTTAGG - Intronic
1011789320 6:90880917-90880939 TCTAGAATTTTCATAGTTTCAGG + Intergenic
1011900447 6:92288305-92288327 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
1011921457 6:92582022-92582044 TCCAGAATTTTTATAGTTTTGGG - Intergenic
1012008085 6:93742151-93742173 TCCAGAGTTTTCATAGTTTGTGG - Intergenic
1012410492 6:98950336-98950358 TCTAGAAGTTTCATAGTTTTGGG + Intergenic
1012577081 6:100815800-100815822 TCCAGGATTTTTATAGTTTTAGG - Intronic
1012604216 6:101136974-101136996 TCCAGAAGTTTTATAGTTTTAGG - Intergenic
1012604695 6:101143725-101143747 TCCAGGGTTTTTATAGCTTTAGG + Intergenic
1012810113 6:103946332-103946354 TCCAGAGTGTTTATAGTTTTAGG + Intergenic
1012830425 6:104197784-104197806 TCCAGAGTTTTTATAGTTTTAGG - Intergenic
1013045806 6:106483959-106483981 TCTAGTAGGTTCATAGTTTTGGG + Intergenic
1013314919 6:108932349-108932371 TCCAGGGTCTTCATAGTTTTGGG + Intronic
1013744162 6:113325022-113325044 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1013932426 6:115550045-115550067 TCCAGGATTTTCATAGTTTTGGG - Intergenic
1013940643 6:115657351-115657373 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1014029745 6:116686654-116686676 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1014167265 6:118239345-118239367 CCCAGAATGTTCATAGAGGTAGG + Intronic
1014244165 6:119049713-119049735 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015240192 6:131013630-131013652 TACAGATTGTTCAGACCTTTTGG + Intronic
1015288934 6:131515974-131515996 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1015361960 6:132350236-132350258 TCTAGAATTTTTATAGCTTCAGG + Intronic
1015500679 6:133930415-133930437 TCTAGAAATTTCATAGTTTTAGG + Intergenic
1015664471 6:135612376-135612398 TCCAGTAGTTTCATAGCTTCAGG + Intergenic
1015668679 6:135662204-135662226 TCCAGTATGTTGTTAGCTATGGG - Intergenic
1016074943 6:139784853-139784875 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1016289561 6:142513705-142513727 TCTAGAATTTTTATAGCTTCAGG + Intergenic
1016379992 6:143467440-143467462 TGCAGAATGTTCATTGCTACTGG - Intronic
1016453194 6:144204843-144204865 TCCAGAGTTTTTATAGATTTGGG + Intergenic
1016571035 6:145512945-145512967 TCCAGAATTTTTATAGTTTCAGG - Intronic
1016617061 6:146062553-146062575 TTCAGGATGTTTATAGTTTTTGG + Intronic
1016630661 6:146226374-146226396 ACCAGAATTTTCATGCCTTTTGG + Intronic
1016652535 6:146479314-146479336 TCCAGAGTTTTTATAGATTTAGG + Intergenic
1016991287 6:149930718-149930740 TCCAGAATTTTTATAGTTTTAGG - Intergenic
1016994209 6:149949904-149949926 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1017004130 6:150017643-150017665 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1017265676 6:152442734-152442756 CCCAGACTGTTCCAAGCTTTTGG - Intronic
1017296591 6:152803214-152803236 TCCAGAATTTTTATAGGTTGAGG + Intergenic
1019834648 7:3370784-3370806 TACACAGTGTGCATAGCTTTGGG + Intronic
1019853274 7:3580659-3580681 TCCAGAGTTTTTATAGTTTTGGG - Intronic
1020380424 7:7539037-7539059 CCCAGAAATTTCAGAGCTTTGGG - Intergenic
1020423617 7:8038634-8038656 TCCAAAATGTTTATAGGTTCAGG - Intronic
1020582801 7:10026861-10026883 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1021053096 7:16013485-16013507 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1021780011 7:24095042-24095064 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1021856076 7:24857709-24857731 TCCAGGATGTTAATAGCTGTTGG + Intronic
1022075836 7:26969291-26969313 TCCAGAGTTTTTATAGTTTTGGG + Intronic
1023720313 7:43086474-43086496 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1024340743 7:48256408-48256430 TCCAGGATATTGATAGTTTTAGG + Intronic
1024432327 7:49303314-49303336 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
1024894018 7:54236048-54236070 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1026424812 7:70280221-70280243 GCCAGAGTGTTCACTGCTTTAGG + Intronic
1027623001 7:80515493-80515515 TCCAGAGAGTTCATGCCTTTTGG + Intronic
1027989502 7:85339049-85339071 TACAGATGGTTCCTAGCTTTAGG + Intergenic
1028428611 7:90720419-90720441 TCCAGAATGTTCACAGCTCATGG + Intronic
1028444844 7:90909778-90909800 TCCAGAAAGTTCTCATCTTTAGG + Intronic
1029053577 7:97716079-97716101 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1030200505 7:106898490-106898512 TCCAGGATTTTTATAGTTTTGGG + Intronic
1031068117 7:117130192-117130214 ATTAGAATTTTCATAGCTTTAGG + Intronic
1031148200 7:118021142-118021164 TCTAGAATTTTTATAGTTTTGGG - Intergenic
1031393304 7:121242399-121242421 TTCAGAATATTCCTAGCATTTGG + Intronic
1031911387 7:127520334-127520356 TCCAGAGTTTTAATAGTTTTGGG - Intergenic
1031995483 7:128227665-128227687 TGCAGAAAGTTCAAATCTTTAGG - Intergenic
1032372012 7:131365554-131365576 TCCAGCGTTTTTATAGCTTTGGG + Intronic
1032773249 7:135081525-135081547 TTAAAAATGTTCATACCTTTTGG - Intronic
1032956493 7:136977848-136977870 TCCAGAATTTGTATAGCTTGAGG + Intronic
1033114695 7:138615034-138615056 TTCAGCATGTCCATGGCTTTGGG - Intronic
1033997806 7:147373428-147373450 TTCAGAAAGTTCAAAGCTGTAGG - Intronic
1034363892 7:150528361-150528383 TCCAGGGTGTTCATACTTTTGGG + Intergenic
1035031219 7:155862132-155862154 TGTAGAATGTTGAAAGCTTTGGG + Intergenic
1035069704 7:156133677-156133699 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1035110495 7:156477885-156477907 TCCAGTAGTTTCATAGTTTTGGG - Intergenic
1035645778 8:1218199-1218221 TCCAGATTTTTTATAGTTTTAGG + Intergenic
1036539997 8:9697330-9697352 TCTAGAATTTTTATAGTTTTAGG - Intronic
1040669554 8:49672954-49672976 TCTAGAGTTTTCATAGTTTTGGG - Intergenic
1040966733 8:53089670-53089692 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
1041013568 8:53568875-53568897 TCCAGGGTTTTTATAGCTTTTGG + Intergenic
1041278060 8:56183862-56183884 TCCAGAAGTTTTATAGTTTTAGG - Intronic
1041732124 8:61073303-61073325 TGTAAAATGTTCGTAGCTTTAGG + Intronic
1041832407 8:62169561-62169583 TCCAGAATCTTTATGGTTTTAGG - Intergenic
1041864692 8:62558019-62558041 TCCAGAATTTTTATAGTTTCAGG + Intronic
1043237508 8:77886954-77886976 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1043261324 8:78202303-78202325 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1043278683 8:78435514-78435536 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1043336709 8:79185136-79185158 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1043568417 8:81573060-81573082 TCTAGAATTTTTATAGCTTCAGG + Intergenic
1043689753 8:83135657-83135679 TCCAGATTGTGCATAATTTTTGG - Intergenic
1043727100 8:83624601-83624623 TCCAGAATTTTCATAGATTTGGG + Intergenic
1043806108 8:84673482-84673504 TCCAGGATTTTTATAGGTTTGGG + Intronic
1043816469 8:84808114-84808136 TCTAGAATGTTTATAGTTTCAGG + Intronic
1044170642 8:89047674-89047696 TCCAGGATTTTTACAGCTTTAGG + Intergenic
1044947483 8:97403479-97403501 TCTAGAATTTTCATGGCTTCAGG + Intergenic
1044959922 8:97520342-97520364 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1045095357 8:98791844-98791866 TCCAGAATTTTTATAGTTTCAGG - Intronic
1045729390 8:105217589-105217611 TCCAGGATGTTTATAGCTTCAGG + Intronic
1045745523 8:105415257-105415279 ACCAGTGTGTTCATAGCTTGAGG + Intronic
1046279511 8:112007261-112007283 TCCAGGATTTTCATAGTTTTAGG + Intergenic
1046323161 8:112604668-112604690 TTCAGAACTTTTATAGCTTTAGG - Intronic
1046398886 8:113677273-113677295 TCTAGAGTTTTTATAGCTTTGGG - Intergenic
1046453190 8:114420819-114420841 TCCAGAATTTTTATAGTTTGGGG - Intergenic
1046895585 8:119468522-119468544 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1047111650 8:121796055-121796077 TCCAAAATTTACATAGGTTTAGG + Intergenic
1047523761 8:125615466-125615488 TCCAGAATGCTCTTTACTTTGGG + Intergenic
1048040038 8:130718292-130718314 TCCAGAATTTTTGTAGCTTCAGG - Intergenic
1048425679 8:134321126-134321148 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
1048545546 8:135383575-135383597 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1048701580 8:137096913-137096935 TCCAGAGTGTTTATAGTTTGGGG - Intergenic
1049805983 8:144539515-144539537 TCCAGAAGTTTTATAGTTTTAGG + Intronic
1050139599 9:2503491-2503513 TCCAGAATGTACATTCTTTTTGG - Intergenic
1050440011 9:5651514-5651536 TCCAGTAGTTTCATAGTTTTGGG + Intronic
1050999155 9:12258764-12258786 TCTAGAATGTTTATAGTTTCAGG - Intergenic
1051575684 9:18612750-18612772 TCCAGGATTTTTATAGTTTTAGG - Intronic
1051656716 9:19388944-19388966 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1051688693 9:19685799-19685821 TCCAGAGTTTTTATAGTTTTTGG - Intronic
1051700626 9:19819228-19819250 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1051718792 9:20013441-20013463 TCCAGTAGTTTCATAGCTTCAGG - Intergenic
1052139796 9:24966451-24966473 TCCAGAATTTTTATGGTTTTAGG - Intergenic
1053471571 9:38349775-38349797 TCCAGAATTTTCATAGTTTTAGG + Intergenic
1053542571 9:38989836-38989858 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1053631141 9:39939917-39939939 TCCAGAATTTTTATGGTTTTGGG + Intergenic
1053672360 9:40379974-40379996 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1053774628 9:41523588-41523610 TCCAGAATTTTTATGGTTTTGGG - Intergenic
1053807027 9:41813353-41813375 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1053922176 9:43006330-43006352 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1054212746 9:62310781-62310803 TCCAGAATTTTTATGGTTTTGGG - Intergenic
1054383474 9:64520003-64520025 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1054512264 9:65996335-65996357 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1054623565 9:67374074-67374096 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1055523284 9:77104239-77104261 TCCAGGATTTTCATAGTTTTGGG - Intergenic
1055843513 9:80533387-80533409 TCTAGAATTTTTATAGTTTTGGG - Intergenic
1055912283 9:81366481-81366503 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1056127469 9:83550061-83550083 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1056837036 9:89963804-89963826 TGCAAAATAATCATAGCTTTGGG - Intergenic
1057125069 9:92610540-92610562 TCCAGAATTTTCATAGCGCATGG + Intronic
1058102624 9:100934202-100934224 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1058221166 9:102304354-102304376 TCTAGAATTTTCATAGTTTAAGG + Intergenic
1058926651 9:109671217-109671239 TCTAGAGTTTTTATAGCTTTGGG + Intronic
1059180125 9:112204089-112204111 TCTAGAATTTTCTTTGCTTTAGG + Intergenic
1059895817 9:118863582-118863604 TCCAGAGTTTTCAAAGTTTTGGG - Intergenic
1059974881 9:119705242-119705264 TGCAGAATGTTCTTAGCTTGTGG + Intergenic
1060007455 9:120013385-120013407 CCTAGAATGTTCATATCCTTTGG - Intergenic
1060435294 9:123587615-123587637 ACCAAGATGTTCATAGCTCTGGG - Intronic
1061656581 9:132096308-132096330 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1203358028 Un_KI270442v1:180547-180569 TCTAGGATTTTCATAGTTTTAGG - Intergenic
1185852561 X:3502751-3502773 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1186949157 X:14603569-14603591 TCTAGAATTTTTATAGTTTTAGG - Intronic
1187289257 X:17936940-17936962 TCCAGAGTTTTTATAGTTTTAGG + Intergenic
1187714439 X:22088906-22088928 TCCAGAAGTTTTATAGTTTTAGG + Intronic
1188014363 X:25091740-25091762 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1188175532 X:26984292-26984314 TCTAGCACTTTCATAGCTTTGGG - Intergenic
1188234121 X:27705901-27705923 TCCAGAGTTTTCACAGATTTAGG + Intronic
1188319362 X:28716556-28716578 TCCAGAATTTTTATATGTTTGGG - Intronic
1188371264 X:29372525-29372547 TCTAGAATTTTCATAGTTTGAGG + Intronic
1188454838 X:30352293-30352315 TCCAGAGTTTTTATAGGTTTGGG + Intergenic
1189035517 X:37490967-37490989 TCCTGTATGTTCACAGTTTTAGG - Intronic
1189130916 X:38497128-38497150 TCCAGAATTTTTATAGTTTCAGG - Intronic
1189548434 X:42068370-42068392 TCCCGGGTGTTCATAGTTTTGGG - Intergenic
1189775019 X:44462775-44462797 TCCAGAATCTTCATTCCATTTGG - Intergenic
1189868457 X:45356236-45356258 TTCAGTATGATAATAGCTTTGGG + Intergenic
1189881594 X:45499265-45499287 TCCAGAGTTTTAATAGTTTTGGG + Intergenic
1189886469 X:45550250-45550272 TCCAGAAGTTTTATAGCTTTAGG - Intergenic
1189898174 X:45678028-45678050 TCCAGGATTTTCATAGTTTTAGG - Intergenic
1190030214 X:46965123-46965145 TCCAGAATGTCCATAACTATAGG - Intronic
1190958196 X:55218176-55218198 TCCAGGATTTTTATAGTTTTAGG + Intronic
1190965193 X:55293161-55293183 TCCAGGATTTTTATAGTTTTGGG + Intergenic
1191001797 X:55667734-55667756 TCTAGGATTTTCATAGTTTTAGG - Intergenic
1191045709 X:56134538-56134560 TCTAGAATGTTTATAGTTTCAGG - Intergenic
1191153011 X:57241230-57241252 TCCAGGATTTTTATAGTTTTTGG - Intergenic
1191164519 X:57373830-57373852 TCTAGAATTTTCATAGTTTCAGG + Intronic
1191646304 X:63485140-63485162 TCCAGGATTTTCATAGGTTGAGG - Intergenic
1191679590 X:63827191-63827213 TCCAGGATTTTTATAGTTTTAGG + Intergenic
1191730311 X:64327062-64327084 TCCAGTAGTTTCATAGCTTTCGG - Intronic
1191763735 X:64672556-64672578 TCCAGAGTTATTATAGCTTTAGG - Intergenic
1191818818 X:65279600-65279622 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1191822030 X:65320927-65320949 TCTAGAGTTTTCATAGTTTTTGG - Intergenic
1192031576 X:67519022-67519044 TCTAGAATTTTCATAGTTTCAGG + Intergenic
1192629629 X:72767070-72767092 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1192652081 X:72953734-72953756 TCTAGAATTTTCATAGTTTCAGG + Intergenic
1192820650 X:74641713-74641735 TCTAGAATGTTTATAGTTTCAGG - Intergenic
1192956955 X:76081869-76081891 TCCAGAGTTTTTATAGCTCTAGG - Intergenic
1193173225 X:78360889-78360911 TCTAGAATTTTTATAGTTTTGGG - Intergenic
1193199984 X:78677642-78677664 TCCAGGATTTTTATAGTTTTTGG - Intergenic
1193263302 X:79436697-79436719 TCCAGGATTTTTATAGTTTTAGG - Intergenic
1193354334 X:80500101-80500123 TCCAGAATTTTCATGGTTTCAGG - Intergenic
1193354734 X:80505243-80505265 TCCAGAATTTTTATAGTTTCTGG - Intergenic
1193359688 X:80566413-80566435 TCTAGGTTGTTCATAGTTTTAGG + Intergenic
1193423368 X:81311505-81311527 TCCAGAATTTTTATAGTTTCTGG + Intergenic
1193451237 X:81670566-81670588 TCTAGAATTTTCATAGTTTCCGG - Intergenic
1193567794 X:83099776-83099798 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1193581220 X:83265431-83265453 TCCAGGATTTTCATAGTCTTTGG - Intergenic
1193804985 X:85984482-85984504 GCCAGAATGCTCATATATTTTGG + Intronic
1193820982 X:86164545-86164567 TCCAGGATTTTAATAGTTTTGGG + Intronic
1193826081 X:86229078-86229100 TCCAGAATTTTTACAGTTTTAGG + Intronic
1193883343 X:86954437-86954459 TCCAGGGTTTTTATAGCTTTGGG + Intergenic
1194145033 X:90251787-90251809 TCCAGGATTTTTATAGATTTGGG - Intergenic
1194165781 X:90513389-90513411 TCTAGAATTTTTATAGATTTAGG - Intergenic
1194191641 X:90843890-90843912 TCCAGAATTTTTATAGCCTCAGG + Intergenic
1194263583 X:91728915-91728937 TCCAGAGTTTTTATAGTTTTGGG + Intergenic
1194356514 X:92891431-92891453 TCTAGAGTTTTCATAGTTTTGGG + Intergenic
1194372943 X:93096772-93096794 TTCAGAATGCTCATTGCTATTGG - Intergenic
1194468852 X:94267679-94267701 TCAAAAATTTTTATAGCTTTAGG - Intergenic
1194526705 X:94985730-94985752 TCCAGAATTTTCATAGTTTCAGG - Intergenic
1194543068 X:95198903-95198925 TCCAGAATTTTTATAGTTATAGG + Intergenic
1194630818 X:96280937-96280959 TCTAGAATGTTTATGGTTTTAGG - Intergenic
1195209182 X:102635410-102635432 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1196471537 X:116034255-116034277 TCTAGAATTTTCATAGTTTCAGG - Intergenic
1196574111 X:117298858-117298880 TCTAGAGTCTTTATAGCTTTGGG + Intergenic
1196947782 X:120845102-120845124 TCCAGAATTTTTATAGTTTCAGG + Intergenic
1197142788 X:123134968-123134990 TCCAGGATTTTTATAGTTTTGGG - Intergenic
1197183962 X:123565650-123565672 TCTAGAGTGTTTATAGTTTTGGG - Intergenic
1197242824 X:124137868-124137890 TCCAGGATTTTTATAGTTTTAGG + Intronic
1197316426 X:124971654-124971676 ACAAAAATGTTCAAAGCTTTTGG - Intergenic
1197642560 X:128983064-128983086 TCCAGAGTTTTTATAGTTTTGGG - Intergenic
1198285819 X:135190721-135190743 TCTAGTAGTTTCATAGCTTTGGG - Intergenic
1198287305 X:135204009-135204031 TCTAGTAGTTTCATAGCTTTGGG + Intergenic
1198565437 X:137899833-137899855 TCCAGAATTTTTATAGTTTTGGG + Intergenic
1198570530 X:137950749-137950771 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
1198583297 X:138091292-138091314 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1198745572 X:139887235-139887257 TCTAGAAATTTTATAGCTTTAGG - Intronic
1199120896 X:144052730-144052752 TCCAGGCTTTTTATAGCTTTTGG - Intergenic
1199269653 X:145868114-145868136 TCCAGGGTTTTCATAGTTTTGGG + Intergenic
1199316830 X:146388799-146388821 ACCACAATGTTCACAGTTTTTGG - Intergenic
1199354469 X:146845399-146845421 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1199421079 X:147645108-147645130 TCCAGAATTTTTATAGTTTCAGG - Intergenic
1199476516 X:148252461-148252483 TCCAGTAGTTTCATAGTTTTGGG + Intergenic
1200490794 Y:3821081-3821103 TCCAGGATTTTTATAGATTTGGG - Intergenic
1200512051 Y:4091186-4091208 TCTAGAATTTTTATAGTTTTAGG - Intergenic
1200538285 Y:4426325-4426347 TCCAGAATTTTTATAGCCTCAGG + Intergenic
1200664851 Y:6008431-6008453 TCTAGAGTTTTCATAGTTTTGGG + Intergenic
1200680979 Y:6210809-6210831 TTCAGAATGCTCATTGCTATTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200719024 Y:6582803-6582825 TCTAGAATTTTTATAGTTTTAGG + Intergenic
1200743412 Y:6879640-6879662 TCTAGAATTTTCATGGTTTTAGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1202023048 Y:20487626-20487648 TCAAGAATGTTTATAGTTTTTGG - Intergenic
1202068579 Y:20967041-20967063 TCTAGAATTTTTATGGCTTTTGG - Intergenic