ID: 952447224

View in Genome Browser
Species Human (GRCh38)
Location 3:33393078-33393100
Sequence CATCCTAAAGGGCTGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 261}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952447213_952447224 2 Left 952447213 3:33393053-33393075 CCTAGAGTGCCCCAGTGATTGGC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447216_952447224 -9 Left 952447216 3:33393064-33393086 CCAGTGATTGGCTGCATCCTAAA 0: 1
1: 0
2: 0
3: 8
4: 122
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447215_952447224 -8 Left 952447215 3:33393063-33393085 CCCAGTGATTGGCTGCATCCTAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447214_952447224 -7 Left 952447214 3:33393062-33393084 CCCCAGTGATTGGCTGCATCCTA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447211_952447224 3 Left 952447211 3:33393052-33393074 CCCTAGAGTGCCCCAGTGATTGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447208_952447224 20 Left 952447208 3:33393035-33393057 CCAAAGCCTGCCACTATCCCTAG 0: 1
1: 0
2: 0
3: 10
4: 178
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447210_952447224 10 Left 952447210 3:33393045-33393067 CCACTATCCCTAGAGTGCCCCAG 0: 1
1: 0
2: 1
3: 13
4: 148
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261
952447209_952447224 14 Left 952447209 3:33393041-33393063 CCTGCCACTATCCCTAGAGTGCC 0: 1
1: 0
2: 1
3: 7
4: 90
Right 952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952447224 Original CRISPR CATCCTAAAGGGCTGGGGGG AGG Intronic
900429785 1:2596161-2596183 CAGCCTCAAGGGCTTTGGGGAGG + Intronic
900829885 1:4958350-4958372 TCTCCTAATGGGCTGGGGGTCGG + Intergenic
900916870 1:5645381-5645403 CATCCCAAAGGGCAGGGAGTGGG + Intergenic
901707840 1:11089706-11089728 CCTCCCAAAGGGTTGGGGGTTGG - Intronic
904748974 1:32729085-32729107 CATCCTCCCAGGCTGGGGGGTGG + Intergenic
905238311 1:36565626-36565648 CATCCTTATGGGTTGGGGAGGGG - Intergenic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907906279 1:58785344-58785366 CGTCCCTAAGGGGTGGGGGGCGG - Intergenic
911060825 1:93746350-93746372 CATCCTGAAAGGCTGGAGGGAGG - Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
911220686 1:95242052-95242074 CTTCTTAGAAGGCTGGGGGGTGG - Intronic
911440700 1:97921820-97921842 CATCTAACAGGGGTGGGGGGGGG - Intergenic
911606143 1:99907711-99907733 CATCCTAAATGGCTATGAGGTGG + Intronic
912523577 1:110264421-110264443 CTTCCTGAAGGGCTTGGAGGAGG - Intronic
912978212 1:114348564-114348586 GAGCCTGAAGGGCTGGGGGCTGG + Intergenic
913701911 1:121382486-121382508 CACCCTAGAGGGCTGTGAGGTGG - Intronic
914042468 1:144062955-144062977 CACCCTACAGGGCTGTGAGGTGG - Intergenic
914135619 1:144897533-144897555 CACCCTACAGGGCTGTGAGGTGG + Intronic
914804562 1:150982867-150982889 CTTCCTAAAGGAGTGGGGAGAGG + Intronic
915051987 1:153084662-153084684 CATACTATTGGGCTGGGGGCAGG - Intergenic
915053599 1:153103652-153103674 CATACTATTGGGCTGGGGGCAGG - Intronic
915249844 1:154580138-154580160 CTTTGTAAAGGGCTGGGCGGAGG + Intergenic
915280873 1:154821356-154821378 CAGCCTGAAGGGCCGGGGGCTGG + Intronic
915311340 1:155007305-155007327 CAGCCTAGAGGGCAGGGGGCAGG - Intronic
915493272 1:156263559-156263581 CCTCCTCAGAGGCTGGGGGGTGG + Exonic
917968720 1:180194171-180194193 CAGCCTGAAGGGCTGGTGCGTGG + Intronic
920489334 1:206401206-206401228 CACCCTAGAGGGCTGTGAGGCGG - Intronic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
921160371 1:212468098-212468120 CCTCCTAAAGGACTGGGGGGTGG + Intergenic
921793505 1:219316873-219316895 GATCATTAGGGGCTGGGGGGAGG + Intergenic
924937435 1:248784041-248784063 CTTAGTAAAGGGCTGGGGGTGGG - Intergenic
1063177876 10:3568651-3568673 GATCCTATACGGTTGGGGGGTGG - Intergenic
1063649054 10:7915243-7915265 CTTCATAAAAGGCTGGGGAGCGG - Intronic
1063659474 10:8024316-8024338 CCTCCCAAAGTGCTGGGGGGAGG - Intergenic
1063978502 10:11435699-11435721 CATAATAAAAGGCTGGGGTGGGG - Intergenic
1064991399 10:21259823-21259845 CTTCCTAGAGGGCAGGGGGGTGG + Intergenic
1067448843 10:46368991-46369013 CCTCCTACTGGGCTGGGGTGAGG + Intergenic
1067588529 10:47491774-47491796 CCTCCTACTGGGCTGGGGTGAGG - Intergenic
1067635655 10:47999865-47999887 CCTCCTACTGGGCTGGGGTGAGG - Intergenic
1067877864 10:50020530-50020552 CCTCCTACTGGGCTGGGGCGAGG + Intergenic
1069711209 10:70489815-70489837 CATGCTAGCGGGCTGGGGGTGGG - Intronic
1070132213 10:73663872-73663894 CCTCCTACTGGGCTGGGGCGAGG - Intergenic
1070835343 10:79444313-79444335 CTTCAAAAAGGGCTGGGAGGTGG + Intronic
1070858455 10:79628860-79628882 CGTTCTACAGGGATGGGGGGTGG + Intergenic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1072799641 10:98384156-98384178 CAGAATAAGGGGCTGGGGGGAGG + Intronic
1073210343 10:101796263-101796285 CATCTTGTGGGGCTGGGGGGAGG - Intronic
1075664558 10:124221303-124221325 CATCCCACAGGGCTGCTGGGAGG + Intergenic
1075712562 10:124538364-124538386 CATCCCAAAGGGCTGAGAGAAGG - Intronic
1075925141 10:126245489-126245511 CATCCTGAAGGACTGGGCAGTGG + Intronic
1076529415 10:131134701-131134723 CTTCCAGAGGGGCTGGGGGGTGG + Intronic
1076870357 10:133189844-133189866 CATCCCCGAGGGCTGGGGGCAGG - Intronic
1077492135 11:2866442-2866464 CATCCTGCAGAGCTGGGGGGTGG + Intergenic
1077892523 11:6429820-6429842 CAGCTTAAAGGGCTGGGAGCTGG - Intergenic
1079252255 11:18794788-18794810 CATCTTAAAGGGCTATGGGAAGG + Intergenic
1080890564 11:36405537-36405559 CATAACAAAGGGCTGTGGGGAGG - Intronic
1081611435 11:44565535-44565557 CTTCCCAAAGGGCTCGGGGGCGG + Intronic
1083827306 11:65211006-65211028 AATCCTGAAAGGCTGGGGTGGGG + Intronic
1084333675 11:68444977-68444999 CTTCCTAAAGGGCAGGGGAAGGG + Intronic
1086826870 11:91508907-91508929 CATCTTATATGGCTGGTGGGGGG + Intergenic
1088665820 11:112092572-112092594 CATCCTAATGGGGTGTGAGGTGG - Intronic
1089557708 11:119323763-119323785 CATCCTACAGAGCAGGTGGGAGG + Intergenic
1089898879 11:121960686-121960708 CACTCTTAAGGGCTGTGGGGAGG + Intergenic
1090253911 11:125269802-125269824 CATCCTCACGGGGTCGGGGGCGG + Intronic
1090447245 11:126774946-126774968 CATCCTGGAGTGCTGTGGGGTGG - Intronic
1092006385 12:5073977-5073999 CATCCAAAATGGCTGAAGGGTGG - Intergenic
1092468548 12:8757269-8757291 CATCCCAAAGTGTTGGGTGGGGG - Intronic
1094661796 12:32476512-32476534 CATCAGAAAGGGCTGCGTGGAGG - Intronic
1096143263 12:49260181-49260203 TATCCTAAAGGAATGGGGGAAGG + Intronic
1096996868 12:55843598-55843620 CACCCTAAGGGGCTTGGGGCTGG + Intergenic
1097251968 12:57639523-57639545 CAGCCTAGAGGGCTGGGGACAGG + Intergenic
1100656857 12:96656301-96656323 AATCCAAAAGGGGAGGGGGGGGG - Intronic
1101660876 12:106764672-106764694 CAACCTAAATGGCAGTGGGGGGG + Intronic
1101874150 12:108587941-108587963 CATTCTAAAGGGGGAGGGGGAGG - Intergenic
1103639198 12:122335459-122335481 CATCCTAAAAGCTTGGGAGGAGG + Intronic
1104698155 12:130880127-130880149 CATCCTTCATGCCTGGGGGGTGG - Intergenic
1105744698 13:23366320-23366342 CATCCCAAAGGGCTGGAGTGTGG + Intronic
1108690842 13:52857755-52857777 CATCCTTCAGGGCTGGGAGCTGG + Intergenic
1113693103 13:112326028-112326050 CATGCTGAAGGCCTGGTGGGTGG - Intergenic
1113737352 13:112688611-112688633 CACCCTAAGAGGCTTGGGGGCGG + Intergenic
1114144168 14:19954330-19954352 CATCCTAAAGCTGTGGGGGTGGG - Intergenic
1117439421 14:55745973-55745995 CACCCTACAGGGGTGGGGAGAGG - Intergenic
1117818188 14:59619932-59619954 TATCGTAAGGGGCTGGGTGGGGG + Intronic
1118925408 14:70187097-70187119 CACCCGAAGGGGGTGGGGGGAGG - Intronic
1120169482 14:81234486-81234508 CTTGCCAAAGGGCTGGGGGGTGG + Intergenic
1121073682 14:91048780-91048802 AATCCTAAAGTGCTGTGGGAGGG - Intronic
1122113721 14:99517677-99517699 CATCCCGCAGGGCTGGGAGGTGG - Intronic
1125759675 15:42088120-42088142 CGTCCGGAAGGGCTGAGGGGTGG - Intronic
1126506497 15:49410149-49410171 AAGCCTAAAGGGCTGGAGAGTGG - Intronic
1126598601 15:50406207-50406229 AAGCCTAAAGTGCTGGTGGGAGG + Intergenic
1127304929 15:57696333-57696355 CATCCCAGAGGGCTTGAGGGAGG - Intronic
1127319992 15:57834675-57834697 GATCCTAAAGGGCGGGAGTGGGG + Intergenic
1129726784 15:77905549-77905571 CATTTTCAAGGGCTGGCGGGGGG - Intergenic
1129894820 15:79095302-79095324 CAGCCCACAGGGCTGGGAGGTGG - Intergenic
1130410224 15:83641369-83641391 CATCTTAATGGGGTGGGGGGCGG + Intergenic
1134247900 16:12553591-12553613 CATCTTGCAGGGGTGGGGGGTGG - Intronic
1135156583 16:20058020-20058042 CAGCCTAAAGGGCCCAGGGGAGG + Intronic
1135327843 16:21538616-21538638 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1136338196 16:29624641-29624663 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1139334124 16:66219004-66219026 CTTCCTACAGGGCAGGGGAGTGG + Intergenic
1141527201 16:84618753-84618775 CAGCCTCAGGGGCAGGGGGGTGG - Intergenic
1141621990 16:85241267-85241289 CACCCTAGAGGGCTGTGGTGAGG + Intergenic
1141949427 16:87331131-87331153 CTACATAAAGTGCTGGGGGGTGG + Exonic
1142040925 16:87893554-87893576 CGGCCTAAAGGTCTGGAGGGTGG + Intronic
1142955984 17:3522561-3522583 CCTCCCAAAGTGCTGGGGGGTGG - Intronic
1143028590 17:3954886-3954908 CAGCCTAAAGGGCAGGCAGGTGG + Intronic
1143741273 17:8955706-8955728 CATCAAAACGGGCTGGGGAGTGG + Intronic
1146046560 17:29513059-29513081 CATCCTATAAGACGGGGGGGGGG - Intronic
1146545902 17:33738337-33738359 GATCCTGAAGGTCTGGGGGAAGG - Intronic
1147041689 17:37724191-37724213 CATTCTATAGGCCTGGGGTGAGG - Intronic
1147224588 17:38966975-38966997 TATCTTAAAGGTGTGGGGGGCGG - Intronic
1147369079 17:39979452-39979474 CACCCTCCAGGGCTGGGGGGTGG - Intergenic
1148217038 17:45838980-45839002 CATTTTAAGGAGCTGGGGGGTGG - Intergenic
1148356220 17:46977666-46977688 CATCCCATAGGGGTGGGGGTTGG - Intronic
1150594990 17:66595999-66596021 CATCCTGTAGGGATGGGTGGTGG + Intronic
1152546614 17:81003591-81003613 AACCCTAAAGGGCTGGCGGGAGG - Intronic
1155281289 18:24242512-24242534 CATCCTTGGGGGCTGTGGGGAGG - Intronic
1155491052 18:26402249-26402271 CATTCAAAAGGTCTGGGGTGGGG - Intergenic
1156263302 18:35464358-35464380 CACCCTACAGGACTGGGGTGGGG + Intronic
1160583802 18:79901831-79901853 CCTCCTCAAGTGCTGGCGGGCGG - Intergenic
1162030985 19:7917143-7917165 AATCCTTCAGGGCTGGGGGTTGG + Intronic
1162311933 19:9913255-9913277 CATCCTAAATGGCGCGGAGGTGG + Intronic
1162355834 19:10184239-10184261 GTTCCTAAAGGCCTGGTGGGGGG + Intronic
1162488394 19:10976346-10976368 CTCCCTGAAGGGCTGGGGTGAGG - Intronic
1163540865 19:17909386-17909408 TCTCCTAAATGGCTGGGAGGTGG + Intergenic
1163814323 19:19454729-19454751 AAACCTAAGGGGGTGGGGGGGGG - Intronic
1165755912 19:38292895-38292917 CATCTTGAAGGGGTGGTGGGAGG + Intronic
1166345210 19:42161483-42161505 CTTCCTACAGGGCTGTGGAGAGG - Intronic
1167059463 19:47134607-47134629 GATCCTAAAGGGTTGGGGAGGGG + Intronic
1168320838 19:55508654-55508676 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320860 19:55508728-55508750 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320903 19:55508875-55508897 CATCCACAGGGGATGGGGGGAGG + Intronic
925431825 2:3801354-3801376 CACCCTGAAGGGCTGCTGGGAGG + Intronic
926795882 2:16618459-16618481 CTTCCTAATGGGCTGGGCTGGGG - Intronic
927730224 2:25464587-25464609 CATACTCAAGGGCAGGGGTGAGG - Intronic
929309405 2:40405044-40405066 CATCCTATGGGGCTGGGGAGGGG - Intronic
931528404 2:63185405-63185427 CATCCTCAAGGATTTGGGGGTGG - Intronic
932680660 2:73821942-73821964 CAGCCTAAAGGGCTCATGGGTGG + Intergenic
934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG + Intergenic
935679589 2:105624501-105624523 CATCCTATAGTTCTGGGGGTCGG + Intergenic
935947867 2:108302304-108302326 CATCCTCAATGGATGGGTGGAGG + Intronic
937878751 2:126849581-126849603 GACTCTAAAGGGATGGGGGGAGG - Intergenic
940659879 2:156532983-156533005 AAGCCTAAAGGCCTGAGGGGTGG + Intronic
941189143 2:162354831-162354853 CATTCTAATGGGCTATGGGGAGG + Intronic
941480751 2:166007231-166007253 CATAATAAAGGGCTCAGGGGAGG + Intronic
943323574 2:186473330-186473352 CATCCTGAAGGGAGGTGGGGGGG + Intergenic
943575812 2:189629908-189629930 CAACATCAAGGGCTGGGGGCAGG + Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946335809 2:219035803-219035825 CATCCCCAAGGGGTGAGGGGTGG - Intronic
947857441 2:233333634-233333656 CATCCTGAAGCTCTGGGGAGTGG + Intronic
947912322 2:233809453-233809475 CATGCAGAGGGGCTGGGGGGCGG + Intronic
1169035247 20:2445450-2445472 CTTCCCAAAAGGCTGGTGGGAGG - Intergenic
1169076116 20:2760632-2760654 CATCCTAGAGGGGTGGGTGGTGG - Intergenic
1169180092 20:3556548-3556570 CATCCTAGAGGGGTCGAGGGAGG + Intronic
1169273503 20:4217994-4218016 GATCCTCAAGGGATGGGGTGAGG - Intergenic
1169811844 20:9616561-9616583 CATCCTTCAGGGCTGGGCTGGGG + Intronic
1170472303 20:16680408-16680430 CATTCTAAAGTACTGGGGGTTGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173254736 20:41386329-41386351 CATCATAAAGTGTTGGGGGGGGG + Intergenic
1173407635 20:42780366-42780388 AAACATAAAGGGCTGGGGGCCGG - Intronic
1175146140 20:56897813-56897835 CTTCCTGAAGGGCTTGAGGGAGG - Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1178997702 21:37420330-37420352 CATCCTGATGGGGTGGGGGAAGG - Exonic
1179565609 21:42246001-42246023 CATCCTAGAGAGGTGGGGGCAGG + Intronic
1179805790 21:43836063-43836085 CATCCTGTGGGGCTGGGGTGAGG - Intergenic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG + Exonic
1182085879 22:27560916-27560938 CAACGTCAAGGTCTGGGGGGAGG + Intergenic
1182518489 22:30872065-30872087 GATCCCACAGTGCTGGGGGGTGG + Intronic
1182524713 22:30907969-30907991 CTGCCCAAAGGGCTGGGGAGAGG + Intergenic
1183650604 22:39151541-39151563 CCTCCCAAAGGGCTGCAGGGAGG + Intronic
949478662 3:4472563-4472585 AATCCTATGGGGTTGGGGGGAGG + Intergenic
950214185 3:11146568-11146590 CATCCACAAGGGATGGGGGTAGG + Intronic
951620292 3:24594076-24594098 CATCCTCAAAGGCTGGAGGCAGG - Intergenic
952307489 3:32159016-32159038 CTTCCTAGAGAGCTGCGGGGTGG + Exonic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
953925789 3:46981859-46981881 CCTCCTGAGGGGATGGGGGGTGG - Intronic
954643772 3:52118167-52118189 CATGCTACAAGGCTGGGGGAAGG - Intronic
955063709 3:55516523-55516545 GAACCCAAAGGGCTGGGGGCTGG + Intronic
956767074 3:72492730-72492752 CATCATGAAAGGATGGGGGGGGG + Intergenic
957948925 3:87098962-87098984 CCCCCCAAAGTGCTGGGGGGGGG - Intergenic
958418523 3:93905982-93906004 AATCCTGATGAGCTGGGGGGCGG + Intronic
958638590 3:96777066-96777088 CATTCTAGAGGGCGGCGGGGCGG + Intergenic
960628258 3:119702681-119702703 CCTGGAAAAGGGCTGGGGGGAGG + Intergenic
960884465 3:122380563-122380585 CATGTTGAAGTGCTGGGGGGTGG + Intronic
961262222 3:125611286-125611308 CATTCTAAAGTACTGGGGGTGGG + Intergenic
961459905 3:127043558-127043580 CAGCCTGAAAGGCTGGAGGGAGG + Intergenic
961683799 3:128616423-128616445 GACCCTAAAGGGCTGGGCTGGGG + Intergenic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
962404904 3:135092452-135092474 CATGCTAGAGGGCAGCGGGGAGG - Intronic
967087363 3:186107949-186107971 CTTCCTAAAACGCTGGGGTGAGG - Intronic
968546621 4:1202228-1202250 CATCCTCACCGGCTGGAGGGTGG + Intronic
969521327 4:7679332-7679354 CATCCTAATGGGCTGAATGGTGG + Intronic
969871476 4:10107566-10107588 TATCCTCAAGGGTTGGGGTGAGG - Intronic
970645600 4:18117004-18117026 CAGCTTAAAGGGCAGGGGGATGG + Intergenic
971011609 4:22443963-22443985 AGTCCTAAAGTGATGGGGGGAGG - Intronic
971352126 4:25863565-25863587 CATCCTGAAGGCCTGGGAGCCGG - Intronic
972285378 4:37643048-37643070 AATCTTAAATGGCTGGGAGGAGG - Intronic
973586455 4:52397218-52397240 GTTCCTAATGGGCTGTGGGGCGG - Intergenic
974634301 4:64539417-64539439 TATCCTAAAGTGCTGGGGTAAGG + Intergenic
975152587 4:71037043-71037065 CCTTCTTAAGGGCAGGGGGGTGG - Intergenic
975152601 4:71037087-71037109 CCTTCTTAAGGGCAGGGGGGTGG - Intergenic
976314066 4:83640568-83640590 CATCCTCAGTGGTTGGGGGGTGG + Intergenic
977628246 4:99212634-99212656 CATTTTAAAAGGCTGGGGGTGGG - Intronic
978542406 4:109832165-109832187 GATCCTAAAGGGGTGTGAGGGGG - Intronic
980985220 4:139688808-139688830 TATTATAAAGGGCTGGGGGCTGG + Intronic
982073272 4:151714338-151714360 GGTCCTAAAGGGGTGGGAGGAGG + Intronic
984241033 4:177219473-177219495 CATCCTGAGGGACTGGGGAGAGG + Intergenic
984478254 4:180264998-180265020 CATCATAATGGGCAGGGTGGTGG - Intergenic
984638631 4:182140996-182141018 CCTCTCAAAGGGCTGGGGGGCGG - Intergenic
985793423 5:1945137-1945159 CATCCCACCGGGGTGGGGGGCGG - Intergenic
985793515 5:1945619-1945641 CATCCTAACGAGCAGGGCGGTGG + Intergenic
986777513 5:11031381-11031403 CCTGCTACAGGGCTGAGGGGTGG + Intronic
990842166 5:60094476-60094498 CATTCTAAAGTACTGGGGGTGGG - Intronic
992261720 5:74977432-74977454 GATACAAAAGGGCTGGGGTGTGG + Intergenic
994314490 5:98316556-98316578 CATACAAAAGGGCTGGTGGGGGG + Intergenic
997819681 5:137053646-137053668 CATCCTTAATGGGTGGGGGGTGG + Intronic
998431859 5:142075766-142075788 CATCCGAAAGGGAGGTGGGGGGG - Intergenic
999283756 5:150381893-150381915 TCTCCTAAAGTGCTGGGGGCAGG + Intronic
1000281806 5:159788887-159788909 CATCCAAGAGGGCTGAGGGCGGG + Intergenic
1001048568 5:168395309-168395331 CGTCCTCAAGGGGTGTGGGGCGG - Intronic
1001427432 5:171632728-171632750 GATCCTAAAGGGCTGTGGGAGGG - Intergenic
1002561288 5:180083998-180084020 CTTCCTAGAGGCCTAGGGGGAGG + Intergenic
1006341441 6:33449208-33449230 CGTCCTTAGGGGCTGGGGGTGGG + Intronic
1006427512 6:33975716-33975738 GATCCCAAAGGCCTGGGGAGGGG + Intergenic
1006442276 6:34060040-34060062 CAGACTCCAGGGCTGGGGGGTGG + Intronic
1007812922 6:44498996-44499018 CAACCAAAAGGGCTGGGGAGAGG - Intergenic
1009197277 6:60702301-60702323 CCTCCCAAAGTGCTGGGGGTTGG + Intergenic
1011585232 6:88917628-88917650 CCTCCCAAAGTGCTGGGGTGGGG - Intronic
1012263394 6:97113214-97113236 CCTACTAAAGGGATGTGGGGTGG + Intronic
1013934539 6:115578129-115578151 CATCCCAAAGTGCTGGGAAGTGG + Intergenic
1015455708 6:133424511-133424533 CATCCTTATAGGCTGGGGGGGGG - Intronic
1015520868 6:134130086-134130108 CCTCCCAAATTGCTGGGGGGTGG + Intergenic
1016029124 6:139319521-139319543 CCTCCCAAAGTGCTGGGGTGTGG - Intergenic
1017140077 6:151182344-151182366 CCTCCCAAAGTGCTGGGGGTGGG - Intergenic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1019916744 7:4138230-4138252 CATCCTAAAGGTCAGGGGAGGGG + Intronic
1021640393 7:22730550-22730572 GATCCTAAAGGGATGGTGAGAGG + Intronic
1023319252 7:38975882-38975904 CTTCCTATGGGGCTGGGGGCTGG - Intergenic
1024531754 7:50399713-50399735 CATACTGACGGGCTGGGGGAAGG - Intronic
1026436681 7:70405233-70405255 CATTCAAAAGGGCAGGGAGGAGG - Intronic
1027593095 7:80138912-80138934 CATCCCAAAGGGCTGCCTGGTGG - Intronic
1028983405 7:96992049-96992071 CTTCTGAAGGGGCTGGGGGGCGG + Intergenic
1029437439 7:100571079-100571101 TACCCTAAGGGGCTGGGTGGGGG + Intergenic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1032985862 7:137336531-137336553 CATGCTCAAGGCCTGGGGGTTGG - Intronic
1033106332 7:138528786-138528808 CTACCTAAAAGGATGGGGGGGGG - Intronic
1033277722 7:139985301-139985323 CAGGCTAGAGGGGTGGGGGGTGG - Intronic
1036696353 8:10977541-10977563 CATGCTAATGGGCTGGGGCTTGG - Intronic
1037857821 8:22384183-22384205 CATCCTGAAATGCTGGGGGAGGG - Intronic
1038411123 8:27360617-27360639 AATCATAAAGGGGTGGGGGTGGG + Intronic
1041895232 8:62916937-62916959 GATCCTAAAGGGGGGTGGGGTGG - Intronic
1042373249 8:68017276-68017298 CTTCTTAAAAGGCTGGGGGTGGG + Intronic
1042444510 8:68868470-68868492 CATCATAAATGATTGGGGGGTGG + Intergenic
1042592792 8:70413919-70413941 CATCTAAAAGGGCATGGGGGTGG - Intergenic
1044935780 8:97292394-97292416 GATCATAAAGGGCAGGGGGATGG + Intergenic
1047559676 8:125973093-125973115 CATTTTAAAGGGCTTGAGGGAGG - Intergenic
1047732018 8:127736026-127736048 CATTATAAAGGGCCGGTGGGCGG - Intronic
1048328292 8:133455154-133455176 CACCCTAAGGGGCGGGGGGCTGG + Exonic
1048922832 8:139246478-139246500 CAGCCTAAAGGACTGGAGGTAGG - Intergenic
1049535239 8:143177227-143177249 GATCCAGAACGGCTGGGGGGTGG - Intergenic
1049731264 8:144179732-144179754 CACCCTGCAGGGGTGGGGGGTGG + Intronic
1049985088 9:942985-943007 CATCATATAGGGTTGGGGGGAGG - Intronic
1049990870 9:990393-990415 CATCCTCAAGGGCTGTGGCGGGG + Exonic
1051064257 9:13083154-13083176 CATCCCAAGGGAGTGGGGGGAGG - Intergenic
1053339599 9:37312664-37312686 CCTCCCAAAGGGCTGGGTTGTGG - Intronic
1054871291 9:70049202-70049224 CATCATGAAGGGGTGGGGTGGGG + Intronic
1055756164 9:79560010-79560032 CATCAGAAAGGGCAGGGGGGAGG - Intergenic
1056269593 9:84933984-84934006 CACCCCAAATGGCTGGGCGGAGG - Intronic
1056929911 9:90865802-90865824 CTTCCTAACAGGCTGGAGGGAGG - Intronic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057354746 9:94323898-94323920 CATCACATGGGGCTGGGGGGAGG - Intronic
1057653013 9:96933739-96933761 CATCACATGGGGCTGGGGGGAGG + Intronic
1057707634 9:97408075-97408097 CATCCTCAAGGGCTGTAGAGAGG - Intergenic
1057714824 9:97484276-97484298 CATCCTGCAGGGCTTTGGGGAGG - Intronic
1057809918 9:98249976-98249998 CACCCTTAAGGGCTAGCGGGTGG + Intronic
1059539939 9:115120166-115120188 AATCCTAAAGAACTGGGGAGAGG - Intergenic
1060425282 9:123499395-123499417 TATCATAAAGGGTTGTGGGGAGG + Intronic
1061632692 9:131883161-131883183 CCTCCCAAAGTGCTGGGGAGTGG + Intronic
1061929794 9:133826639-133826661 CATCCTAGGTGGCTGGGGGAGGG - Intronic
1062440144 9:136566120-136566142 CATCCCAAAGGCCTGGGGCCTGG - Intergenic
1062679340 9:137769529-137769551 CCTCTTTAAGGGCTGGGGGGTGG - Intronic
1188486866 X:30691726-30691748 CCTCCCAAAGTGCTGGTGGGAGG + Intronic
1192594959 X:72396589-72396611 TATCCTTCAGGGCTGTGGGGAGG + Intronic
1197770628 X:130086972-130086994 CAACCCAAAGTGCTGGGGCGGGG - Intronic
1198568582 X:137931786-137931808 CCTCCCAAAGTGCTGGGAGGAGG - Intergenic
1200073606 X:153540695-153540717 CATCTTACAGAGCTGGGGAGGGG + Intronic
1200216334 X:154369666-154369688 CCCCCTAAAGAGCTGGGGTGTGG + Intronic
1201852901 Y:18507203-18507225 CCTCCTAAAGTGCTGGGGTCAGG + Intergenic
1201880420 Y:18813181-18813203 CCTCCTAAAGTGCTGGGGTCAGG - Intronic