ID: 952451760

View in Genome Browser
Species Human (GRCh38)
Location 3:33440054-33440076
Sequence GGGTGGCGCTGCCGGCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952451760_952451770 10 Left 952451760 3:33440054-33440076 CCGGGCCGCCGGCAGCGCCACCC 0: 1
1: 0
2: 3
3: 38
4: 408
Right 952451770 3:33440087-33440109 ACCGGCCCTGCGCCTCATGCCGG 0: 1
1: 0
2: 0
3: 4
4: 92
952451760_952451764 -8 Left 952451760 3:33440054-33440076 CCGGGCCGCCGGCAGCGCCACCC 0: 1
1: 0
2: 3
3: 38
4: 408
Right 952451764 3:33440069-33440091 CGCCACCCTCCCGCGGACACCGG 0: 1
1: 0
2: 1
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952451760 Original CRISPR GGGTGGCGCTGCCGGCGGCC CGG (reversed) Exonic
900134172 1:1107167-1107189 GGGCAGCTCTGCCTGCGGCCAGG + Intronic
900156228 1:1204366-1204388 GGTGGGCCCTGCCGGTGGCCGGG - Intronic
900303197 1:1988271-1988293 GGGTGGCGCTGGGGGCAGCGGGG + Intronic
900393508 1:2443860-2443882 GGGAGGCGCAGTCAGCGGCCGGG - Intronic
900462670 1:2809004-2809026 GGGTGGGGCTGCCGTGGGCCTGG + Intergenic
900968537 1:5976332-5976354 GGGAGGCGCTTCCCGTGGCCAGG - Intronic
901056056 1:6449052-6449074 GAGCGGCGCTGCCCGCAGCCAGG - Exonic
901086327 1:6614180-6614202 GGGCGGCGCTCCGGGCGACCGGG - Intronic
901373199 1:8817768-8817790 GTGTGACGCGGCCGGGGGCCCGG + Intergenic
901506672 1:9689698-9689720 GGGTGTCGCTGCCGGGGGCGGGG - Intronic
902478301 1:16699443-16699465 GAGCGGCGCTGCCCGCAGCCAGG + Intergenic
903263160 1:22142259-22142281 GGCTGGCGCTGGCGCTGGCCGGG - Intronic
903777089 1:25800198-25800220 GGCGGCGGCTGCCGGCGGCCCGG - Exonic
904584652 1:31573457-31573479 GGGCTGCGCTGCCGGGGGTCCGG + Intergenic
904858743 1:33519487-33519509 CGGTGGCGGTGGTGGCGGCCAGG + Exonic
905449163 1:38046227-38046249 GGGGGGCGGCGGCGGCGGCCTGG - Exonic
906240147 1:44237897-44237919 AGGTAGTGCTGCCGGCCGCCGGG - Intronic
907341220 1:53737879-53737901 CGGTGGCGGCGCAGGCGGCCGGG + Intergenic
907403457 1:54239774-54239796 GGGTGGAGCTGGCCGCAGCCGGG - Intronic
908117277 1:60952540-60952562 GGGTGGGGGTGCTGGTGGCCAGG + Intronic
910430069 1:87151625-87151647 GCGTGGCGCTCCCAGCGACCAGG - Intronic
911527588 1:99004911-99004933 GGGCGGCGCTTGCGGCGGGCAGG - Intronic
912097344 1:106161596-106161618 TGGGGGCGCTGCAGGAGGCCAGG - Intergenic
912167275 1:107056583-107056605 GGGTCGCCCGGCCGGCGGCGCGG - Intergenic
915165722 1:153946727-153946749 GGGTCGGGCTGCAGGCGGCTGGG - Intergenic
915319991 1:155051315-155051337 CGGAGGAGCGGCCGGCGGCCAGG - Exonic
915616990 1:157046224-157046246 CGGTGGCGGTGGCGGCGGCGGGG - Intergenic
919803905 1:201369482-201369504 GGGTGGCGCTGCTGTCTTCCAGG + Intronic
920616356 1:207496365-207496387 TGCTTGCGCTGCCGGTGGCCTGG + Exonic
920632861 1:207669542-207669564 TGCTCGCGCTGCCGGTGGCCTGG + Intronic
921189861 1:212699726-212699748 GCAGGACGCTGCCGGCGGCCGGG + Exonic
922196725 1:223365031-223365053 GGGAGGCGCTCCCGGGGGCGGGG + Intergenic
924052605 1:240093023-240093045 GGGTTGCGCTGCCGGGAGACTGG - Exonic
924853877 1:247857199-247857221 GGGAGACGGTGCGGGCGGCCGGG + Exonic
1063417920 10:5889265-5889287 AGGAGGAGCTGCAGGCGGCCGGG - Exonic
1064018337 10:11790149-11790171 GGGTGGCACTGGCGGAGGCGGGG - Intergenic
1065512474 10:26492940-26492962 TGGGGGCGCTGCAGGAGGCCAGG + Intronic
1066465140 10:35643415-35643437 GAGGGGGGCTGCGGGCGGCCCGG + Intergenic
1067587566 10:47484993-47485015 GGCTGGGGATGGCGGCGGCCAGG - Intergenic
1067634621 10:47992759-47992781 GGCTGGGGATGGCGGCGGCCAGG - Intergenic
1067769894 10:49115535-49115557 GGGGCGGGCTGGCGGCGGCCGGG - Intergenic
1068560838 10:58512945-58512967 GGGTGGCGTGGGCGGCGCCCGGG + Intergenic
1069642522 10:69964898-69964920 GGGTGGCCATGCCGGGTGCCTGG + Intergenic
1069738351 10:70672348-70672370 GAGTGCAGCTGCCTGCGGCCGGG - Intergenic
1069818394 10:71212860-71212882 GGCTGGCGCTGCCGGGCGCCGGG + Exonic
1070290669 10:75111523-75111545 GCGCGGCGGTGACGGCGGCCGGG + Intronic
1070482455 10:76896117-76896139 TGGGGGCGCTGCAGGAGGCCAGG + Intronic
1072710821 10:97714566-97714588 CGGCGGCGCTGCCGTCGGGCGGG - Exonic
1072930674 10:99659478-99659500 ACGTGGCGCCGCCGCCGGCCGGG + Intergenic
1073363617 10:102919104-102919126 GGGTGGCGCCGTCGGGGGCAAGG + Exonic
1073533555 10:104254788-104254810 GGGTGGAGCTGGCGGCCGCCGGG + Exonic
1076146516 10:128126387-128126409 GGCTGACGCTGCGGGCGGGCGGG - Intergenic
1076345164 10:129774550-129774572 GGGTGTCGCTGTCGGCTTCCTGG + Intergenic
1076599548 10:131647984-131648006 GGGAGGCGCTGGCGGGGGGCAGG - Intergenic
1076723711 10:132403934-132403956 GGGTGGGGCTGCGCGTGGCCCGG - Intronic
1076776394 10:132700263-132700285 GCGTGTCGCTGTCTGCGGCCTGG + Intronic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076829206 10:132985814-132985836 GGGTGGGGCTGCTGGGGGTCGGG + Intergenic
1077031792 11:471756-471778 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031857 11:471980-472002 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031864 11:472002-472024 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031893 11:472103-472125 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077155544 11:1089352-1089374 GGTTGGCCCTGCCGGGGCCCTGG + Intergenic
1077327317 11:1969393-1969415 GGGTGGGGCTGCCCGGGGGCTGG - Intronic
1077976356 11:7252179-7252201 GGGGGGCGATGCCCGGGGCCAGG + Exonic
1078022238 11:7665603-7665625 GGGTGGGTGTGCAGGCGGCCTGG - Intronic
1078060383 11:8039300-8039322 GTGTGGAGCTGCCGGAGCCCTGG - Intronic
1078266447 11:9758879-9758901 CGAGGGCGCTGCAGGCGGCCTGG + Intergenic
1080582866 11:33657914-33657936 GGGTGGCCCTGTGGGGGGCCAGG + Intronic
1082002371 11:47400263-47400285 GGGGGGCGGGGCCGGGGGCCGGG - Intergenic
1083614116 11:64018092-64018114 GGGTGGAGCTGGGGGAGGCCAGG + Intronic
1083747742 11:64744927-64744949 GGGTGGCGCAGCCGGCGGTGCGG - Intronic
1084091505 11:66882001-66882023 TGGTGGCCCTGCTGGAGGCCAGG - Intronic
1084129169 11:67119724-67119746 GGAGGGCGCTCCCTGCGGCCGGG + Exonic
1084747366 11:71181770-71181792 AGGTGGCTCTGACGGCGTCCAGG - Intronic
1084793344 11:71488970-71488992 GGGTGGCTTTGCTGGGGGCCTGG + Intronic
1085392062 11:76187311-76187333 GGGAGACGCTGCCGGCTGCCTGG - Intronic
1085480476 11:76819065-76819087 GGGTGGCGTTGCATGTGGCCAGG - Intergenic
1086064736 11:82733154-82733176 AGGTGGCTGCGCCGGCGGCCGGG - Exonic
1089346977 11:117796967-117796989 GGGTGGCGCGGCTGGCGGCGAGG - Intronic
1089520002 11:119057075-119057097 GGGGGGCGCTGCCGGCCTCGTGG - Exonic
1202810299 11_KI270721v1_random:24573-24595 GGGTGGGGCTGCCCGGGGGCTGG - Intergenic
1091433275 12:454030-454052 GGGGAGCGCTGCAGGCAGCCCGG - Intergenic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1092262759 12:6961257-6961279 GGTTGGCCCTGCCTGGGGCCTGG - Exonic
1094377114 12:29801965-29801987 TGGGGGCGCTGCAGGCGGCCGGG + Intergenic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1096192641 12:49630564-49630586 GGCAGGCGCTGCTGGGGGCCGGG - Exonic
1096807663 12:54150336-54150358 GGGTGGTGCTGCCAGGGGCAGGG + Intergenic
1097990256 12:65825585-65825607 GGGAGCCGCGGCGGGCGGCCCGG + Intronic
1100632299 12:96400610-96400632 CGGGGGCGGGGCCGGCGGCCGGG + Intergenic
1102277871 12:111597853-111597875 GGGTGGCGGTGCTGGTGGCAGGG - Intronic
1102933800 12:116881056-116881078 AGGTGGCGGCGCTGGCGGCCTGG - Exonic
1102973478 12:117189957-117189979 GGGTGACGCTGGCGGCGGCGCGG - Intronic
1103309125 12:119990044-119990066 AGCTGGCGCTGCTGGCGGCCGGG + Exonic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1104787158 12:131457154-131457176 GGGTGGTGCTGGCGGAGCCCAGG - Intergenic
1105389210 13:19959199-19959221 GGGCGGGGGTGCCGGCCGCCCGG + Intronic
1105814003 13:24016873-24016895 GGATGGCGCTGCCCCCGCCCAGG + Intronic
1106243396 13:27927544-27927566 GGGAGGGGCTGCCGGGGGACTGG - Intergenic
1110005032 13:70255509-70255531 GGGTGTCACTGCCGGCAGCTCGG - Intergenic
1110705919 13:78602140-78602162 GGGGGGCGGCGGCGGCGGCCCGG - Exonic
1112768759 13:102773642-102773664 GGTTGGCGCCGCCGGCTGACGGG - Intronic
1113378624 13:109784788-109784810 AGGTGGCGCTGCTGCCGGCAGGG - Exonic
1113726470 13:112606478-112606500 GGGTGGGGCAGCCCGTGGCCTGG - Intergenic
1113794923 13:113051276-113051298 GGGCGGCTCTGGGGGCGGCCTGG + Intronic
1113800447 13:113083596-113083618 GGGCGGCGCTGCCTAGGGCCAGG + Intronic
1113846405 13:113394127-113394149 AGGGGGCGCTGCCGGCCTCCCGG - Intergenic
1113927737 13:113950881-113950903 GGGTGGCTCTGCCGGGAGACAGG - Intergenic
1113962275 13:114132647-114132669 GGGAGGCTCCGCCCGCGGCCCGG + Intergenic
1115399365 14:32939549-32939571 GAGAGGCTCTGGCGGCGGCCGGG + Intronic
1115545492 14:34462178-34462200 GGATGGCGCTGGCGCGGGCCTGG - Exonic
1118776808 14:68978702-68978724 AGGTGGCGCCGCTGGCGGGCAGG - Intronic
1118911344 14:70064541-70064563 GGGTGGTGGTGGCGGCGGCGGGG + Intronic
1121342774 14:93115328-93115350 GCGGGGCGCGGCGGGCGGCCGGG + Intronic
1121546955 14:94769787-94769809 GGGAGCCGCTGACCGCGGCCGGG + Exonic
1122098595 14:99389394-99389416 TGGTGGCGGTGCCGCCCGCCGGG - Intergenic
1122697406 14:103562753-103562775 GCGTGGCGCTGCCGGCGGCTAGG - Intronic
1122788153 14:104173395-104173417 GGCTGGTGCTGCGGGCCGCCAGG - Exonic
1122825371 14:104368105-104368127 GGGAGAGGCTGCAGGCGGCCAGG + Intergenic
1122956517 14:105073977-105073999 GGGTGGTGGTGCCGGGGGCGTGG - Intergenic
1123505832 15:20941045-20941067 TGGTTGCACTGCCGGCGGCATGG + Intergenic
1123563067 15:21514751-21514773 TGGTTGCACTGCCGGCGGCATGG + Intergenic
1123599314 15:21952034-21952056 TGGTTGCACTGCCGGCGGCATGG + Intergenic
1123711563 15:22991516-22991538 GGGAGGCGCTGGCGGAGGCTTGG + Intronic
1123739985 15:23226574-23226596 GGTGGGCGGAGCCGGCGGCCTGG + Intergenic
1124291209 15:28455542-28455564 GGTGGGCGGAGCCGGCGGCCTGG + Intergenic
1124427047 15:29570949-29570971 GCGCGGCGCGGCCGGCGGGCGGG - Intergenic
1124613262 15:31223615-31223637 GGGGGGTGCTGCAGGCGTCCTGG + Intergenic
1125698513 15:41660024-41660046 GGGTGGGGCTGGGCGCGGCCGGG + Intronic
1126113339 15:45187876-45187898 GGGGAGCGCTGGGGGCGGCCCGG - Intronic
1126143539 15:45456339-45456361 GGGAGGGGCTGCCTGGGGCCAGG - Intergenic
1128078323 15:64841838-64841860 GGGTGAGGCTTCCGGGGGCCGGG - Intergenic
1128498968 15:68214104-68214126 AGGCGGAGCTGCCGGTGGCCTGG - Intronic
1129468775 15:75738736-75738758 GGTTGGCGCCGCTGGCGGCGGGG - Intergenic
1129701094 15:77769104-77769126 GCGTGGTGCTGGCTGCGGCCAGG - Intronic
1130967091 15:88705536-88705558 GGGTCCCGCTGCCAGCGGCCGGG - Intergenic
1132251897 15:100341038-100341060 CTGCGGCGCCGCCGGCGGCCTGG - Exonic
1132279820 15:100602858-100602880 AGGTGGCGATCCCGGCCGCCGGG - Exonic
1132314364 15:100879639-100879661 GGGTGGAGCCGCCGGCGCTCGGG + Exonic
1132414890 15:101612925-101612947 GGGTGGGGGTGGCGGCAGCCTGG - Intergenic
1202971417 15_KI270727v1_random:241885-241907 TGGTTGCACTGCCGGCGGCATGG + Intergenic
1132552947 16:560753-560775 GGGGGGCGCGGGGGGCGGCCGGG + Intronic
1132682063 16:1146469-1146491 GGGTGGGGCTGCCTCTGGCCTGG - Intergenic
1133071412 16:3249106-3249128 GGGTGCTGCTGCCAGCGGCATGG + Intronic
1133235439 16:4385333-4385355 GGGTGGGGCTGCCGGCCACGCGG + Intronic
1134024180 16:10942011-10942033 GGGTGGCAAGGGCGGCGGCCCGG + Exonic
1134042284 16:11077747-11077769 GCGTGGTGCTGCAGGCGGCCTGG + Intronic
1134149665 16:11796498-11796520 GGGTGGGGCCGCCTGAGGCCCGG - Intronic
1136290273 16:29267458-29267480 GGGTGGCCCTCCTGGCAGCCAGG - Intergenic
1136458354 16:30395138-30395160 GGCTGGCGCTGTCGGCCGGCCGG + Exonic
1136485583 16:30570010-30570032 GGGCGGCGGGGCCGGAGGCCTGG - Exonic
1136535944 16:30899548-30899570 GGGTGGGGGTGCCGGGGGCCTGG + Intronic
1136707562 16:32202122-32202144 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1136760348 16:32727288-32727310 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1136807756 16:33143098-33143120 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1137655263 16:50153569-50153591 CGGCGGCCCTGCGGGCGGCCGGG + Intronic
1139434521 16:66928332-66928354 TGGTGGCCCTGCAGGCAGCCAGG + Intergenic
1141431435 16:83972189-83972211 GAGTGGGGCGGCCGTCGGCCTGG - Intronic
1141682981 16:85554915-85554937 GGGTGCCGCTGCCGAAGGCAGGG - Intergenic
1141690060 16:85591560-85591582 GGGGGGCACTGCCGACAGCCAGG - Intergenic
1142027032 16:87819939-87819961 GGGTGGCACTGCCAGCCGCCCGG - Intergenic
1142262171 16:89048138-89048160 GGCCGGCGCTGCTGGGGGCCAGG + Intergenic
1142336264 16:89491061-89491083 GGGCAGCGCGGCCGGAGGCCGGG - Intronic
1142388674 16:89783704-89783726 GCATGGAGCTGCAGGCGGCCGGG - Intronic
1203062502 16_KI270728v1_random:987610-987632 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1143174898 17:4950016-4950038 GGGTGGCGGGGCAGGTGGCCTGG + Intronic
1143482953 17:7237995-7238017 GGGGGCGGCTGGCGGCGGCCCGG - Intronic
1143676476 17:8436322-8436344 GGCTGGCGGTGACGGAGGCCGGG + Intronic
1145190577 17:20840697-20840719 CGGTGGCGGTGCAGGAGGCCGGG + Intronic
1146281743 17:31549561-31549583 GGGCGGCGCGGCCGGGGGCGGGG - Intergenic
1146370949 17:32265630-32265652 TGGTGGCGCTGCCCGGGGCGGGG - Intergenic
1146403710 17:32519637-32519659 GGGAGGGGCTGTCGGCGGCGAGG - Intronic
1147612114 17:41807969-41807991 TGGCGGCGCTGCGGGCAGCCTGG + Exonic
1147705493 17:42422492-42422514 GGGTGGATCTGCCGGGCGCCCGG + Intronic
1147896507 17:43755166-43755188 GGGGGGCCTTGCCGGCGCCCGGG + Exonic
1148633905 17:49132722-49132744 GGGCGGGGCAGTCGGCGGCCTGG + Intronic
1149430889 17:56594833-56594855 CGGTGGCGCTGTCAGCGGCGCGG + Exonic
1149626519 17:58083918-58083940 TCGTGGCGCTGCTGGAGGCCCGG + Intronic
1150647502 17:66988507-66988529 GGGAGGCCCTGCAGGAGGCCAGG - Intronic
1151490646 17:74430920-74430942 TGGTGGCGGGGCGGGCGGCCCGG - Exonic
1152224589 17:79086832-79086854 GGGTGGGGCTGCCTGCGGGATGG + Intronic
1152617967 17:81346380-81346402 GGGAGGGGCTGCGGGCGGCCGGG + Intergenic
1152654883 17:81514833-81514855 GGATGGCGCTGCCCCGGGCCGGG - Intronic
1152725170 17:81941591-81941613 GGGTGGCTTTGCGGGCGTCCAGG - Exonic
1152735744 17:81996039-81996061 TGGTGGCGCTGCCCCCGGTCAGG - Exonic
1153900677 18:9614671-9614693 GCGGGGCGCGGCCGGGGGCCCGG - Intronic
1156275867 18:35581968-35581990 GGCCGGCGCTGCCTGGGGCCGGG + Intronic
1157279158 18:46334398-46334420 GGCGGGCGCCGCGGGCGGCCGGG + Intronic
1157693148 18:49700118-49700140 GGGTGGCGATGCCTGGGGACAGG - Intergenic
1159946260 18:74446788-74446810 GGTGGGGGCTGCCCGCGGCCAGG + Exonic
1160503092 18:79411817-79411839 GGGTGGCCCTGCTGGCGGTCAGG + Intronic
1160544037 18:79641089-79641111 AGGTGGGGGTGCCGGGGGCCGGG - Intergenic
1160869646 19:1271400-1271422 TGGTGGCTCTGCCGGGGGCCGGG + Exonic
1160996738 19:1885441-1885463 CGGTGGCGGTGCAGGAGGCCGGG - Intronic
1161340451 19:3739031-3739053 GCGTGGCTCTGCCCGGGGCCGGG - Exonic
1161461946 19:4402843-4402865 GGGGGGCGCGGCGCGCGGCCTGG + Intronic
1161698476 19:5783029-5783051 GGCTGGGCCTGCCGGCTGCCTGG + Exonic
1161924882 19:7293315-7293337 GGGTGACGCTGCCTGGGGTCAGG - Intronic
1163102595 19:15107376-15107398 GGGCGGCGCGGCCGGAGCCCGGG + Intergenic
1163158106 19:15449800-15449822 GGGAGGCGGCGCCGCCGGCCAGG + Exonic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1163667649 19:18610778-18610800 GGGGGGCGCTGAGGCCGGCCTGG - Intronic
1164692681 19:30222737-30222759 GGGCCGCGCTCCCGGTGGCCCGG - Intergenic
1164850875 19:31483163-31483185 GGGTGGAGCTGCCCAAGGCCTGG - Intergenic
1165112127 19:33508592-33508614 GGCTGGTGCTGCTGGCGGCTGGG + Intronic
1165408267 19:35643473-35643495 TGGTGTTGCTCCCGGCGGCCTGG - Exonic
1165721293 19:38081724-38081746 CGGTGGCGGTGGCGGTGGCCGGG - Exonic
1165851457 19:38852226-38852248 GGGCGGCGCCGCGCGCGGCCGGG - Intronic
1166091613 19:40512970-40512992 GGCCGGCGGTGCCGTCGGCCCGG + Exonic
1166367303 19:42284195-42284217 GGGCGGCGGCGCCGGCAGCCGGG + Intronic
1166688339 19:44809035-44809057 GGGCGGGGCTGCCGGGGGCGGGG + Intergenic
1167286938 19:48603643-48603665 GGGAGACGCGGCAGGCGGCCAGG + Exonic
1167575282 19:50314877-50314899 GGGGAGCGCGGCGGGCGGCCCGG + Intronic
1167592678 19:50413037-50413059 GGGTGGCACTGCTGGCTTCCAGG + Intronic
1167638488 19:50668106-50668128 GAGTGGCGCAGCCGCGGGCCCGG + Exonic
1168064060 19:53909426-53909448 CGGTGGCGGCGGCGGCGGCCGGG + Exonic
1168108842 19:54180795-54180817 GGGTGGGGCCGCCTCCGGCCCGG + Exonic
1168154013 19:54463353-54463375 GCGAGGCGCAGCCGGAGGCCGGG - Exonic
1168272701 19:55258657-55258679 GGGTGGAGTTGCCGACGGGCGGG + Exonic
1168495030 19:56840641-56840663 TGGTGGCGCCGCCGGGCGCCGGG - Exonic
1168676120 19:58279119-58279141 CTGTGGGGCCGCCGGCGGCCCGG + Exonic
1202712324 1_KI270714v1_random:25271-25293 GAGCGGCGCTGCCCGCAGCCAGG + Intergenic
925044984 2:766364-766386 GGGTGGGGCTGTCGGAGGTCTGG + Intergenic
926148132 2:10409372-10409394 GGGAGGCTGTGCCGGCTGCCAGG - Intronic
927640328 2:24841690-24841712 GGGTGACGCTCCAGGCAGCCAGG + Intronic
927714183 2:25341798-25341820 GAGCGCCGCTGCTGGCGGCCCGG - Intronic
928928048 2:36598128-36598150 GGGCGGCGATGGCGGCGGACGGG - Exonic
929033873 2:37672519-37672541 CGGCGGCGCTGGCGGTGGCCGGG - Intronic
929133655 2:38602704-38602726 AAGAGGCGCTGCCGGCGGCGAGG - Exonic
930091473 2:47534428-47534450 GGGTGGCGGTGGGGGGGGCCTGG - Intronic
931711014 2:64989200-64989222 GGGTGCCGCAGGGGGCGGCCGGG - Intronic
933598553 2:84306538-84306560 TGGGGGCGCTGCAGGAGGCCAGG + Intergenic
934716301 2:96546626-96546648 GGGAGGAGCTGCCCGTGGCCAGG + Intronic
934966804 2:98730947-98730969 TGGGGGCGGCGCCGGCGGCCGGG - Intronic
934993329 2:98936352-98936374 GGGGGGCGCAGGCGCCGGCCTGG + Intergenic
935265098 2:101387155-101387177 GGGTGGCGCGGGGGGCGGCCTGG + Exonic
936110505 2:109660658-109660680 GGGAGGGGCTGACGGCTGCCAGG + Intergenic
936556049 2:113499561-113499583 GGGGGGCTTTGCCGGCTGCCGGG - Exonic
937975857 2:127581751-127581773 GGTGGGCGCTGCCCGAGGCCAGG - Intronic
938236126 2:129708601-129708623 GTATGGGGCTGCCGGCTGCCAGG + Intergenic
940748543 2:157597540-157597562 GGGTTGCGCTGCCGTCGGGCAGG - Intronic
942241178 2:173964913-173964935 GGGATGCGCTCCCGGCGGACCGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
944221762 2:197310550-197310572 GGGCGGCGGCGCCGGCGGGCGGG - Intronic
945043712 2:205763809-205763831 GGGTGGCGCTGCAGGTGGTGCGG + Exonic
946143935 2:217714411-217714433 GGGAGACGCTGCAGCCGGCCTGG + Intronic
947586225 2:231358532-231358554 GGGGAGCGCTGCCTGGGGCCAGG - Intronic
947605597 2:231483518-231483540 AGGTGGCGCTGGCGGCCGGCAGG + Intronic
948102291 2:235384709-235384731 GGGAGGCGCTCGCGGGGGCCTGG - Intergenic
948874309 2:240819070-240819092 GGGGGGCCCTGCCGGCCGCAGGG - Intronic
948893169 2:240916720-240916742 GGGTGGCGCCGCCGATGCCCGGG + Intergenic
1168954907 20:1828035-1828057 GGGTGGGGCGGCCGGTGGCTGGG + Intergenic
1169367318 20:5001636-5001658 GGGGAGCGCTGCCGGGTGCCAGG - Intronic
1169486858 20:6041530-6041552 CGGTGGCGGTGCCGGTGCCCCGG - Exonic
1172028955 20:31968267-31968289 GGGAGGCGGCGGCGGCGGCCGGG + Exonic
1172421996 20:34825595-34825617 GGGTCGGGCTGCGGGCGGCCGGG - Intronic
1172568859 20:35953721-35953743 CGGTGGAGCTGCGGGCGGCCAGG - Exonic
1173146685 20:40530642-40530664 GGGTGGAGCTGCCGCCAGGCAGG + Intergenic
1174298880 20:49568140-49568162 GGCTGGCGGGGCTGGCGGCCTGG + Exonic
1174804178 20:53592701-53592723 GGAGGGCGCTGCTGGGGGCCCGG - Intronic
1175199044 20:57265819-57265841 GGGCGGCGGGCCCGGCGGCCAGG - Exonic
1175399482 20:58692601-58692623 GGGCGGCGCCGCTGGAGGCCGGG + Exonic
1175509561 20:59514754-59514776 GGGTGGCTCTGCCTGCAGCACGG + Intergenic
1175947401 20:62565315-62565337 GGTTGGGCCTGCCGGGGGCCTGG + Intronic
1176040742 20:63064552-63064574 GGGTGGGGCTGGAGGCCGCCCGG + Intergenic
1176074266 20:63241368-63241390 GGCAGGTGCTGCCGGCCGCCTGG + Exonic
1176144917 20:63561308-63561330 GGGTGGAGCTGCCTGCAGCATGG - Intronic
1176146566 20:63568140-63568162 GGGTGCCTCTGCCGGGGCCCTGG - Intronic
1176169474 20:63690475-63690497 GGGTGGCGGAGCGGGCGGCGTGG + Intronic
1176194623 20:63831423-63831445 GAGGGGCGGGGCCGGCGGCCGGG - Intergenic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176382581 21:6120656-6120678 CGGCGGCGCAGCCGGCAGCCGGG + Exonic
1176867799 21:14063554-14063576 GGGCGTCGCTGCCCGCGGCAGGG + Intergenic
1178826716 21:36023677-36023699 AGGTGGGGCTGCTGGCCGCCCGG - Intergenic
1178948380 21:36966641-36966663 GGCTCGCCCTGCCGGCGGCGCGG - Intronic
1179740888 21:43417583-43417605 CGGCGGCGCAGCCGGCAGCCGGG - Exonic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180560104 22:16609137-16609159 GGAGGGCGCTGCTGGGGGCCCGG - Intergenic
1180707473 22:17818269-17818291 GGGTGGCGGTGGGGGCGGGCTGG + Exonic
1180843749 22:18970774-18970796 CGGTGGCCCTCCCGGCCGCCCGG - Intergenic
1181121706 22:20671293-20671315 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1181334674 22:22118333-22118355 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1182083507 22:27545485-27545507 GGGTGGGGCTGCCAGGGGCTGGG - Intergenic
1182123248 22:27800114-27800136 CGGCGGCGCAGCCGGAGGCCTGG - Exonic
1182145140 22:27992904-27992926 GGGTGGTGCTGCCTGGGTCCTGG - Intronic
1182442857 22:30374209-30374231 GGGCTGCGCTGCTGGCCGCCTGG - Intronic
1182686057 22:32122376-32122398 GGGATGCACTGCCTGCGGCCAGG + Intergenic
1182697178 22:32205490-32205512 GGGATGCACTGCCCGCGGCCGGG + Intergenic
1182804377 22:33058075-33058097 GGCTGCCGCTGCCGGGGCCCTGG - Intronic
1183535200 22:38397381-38397403 GGAGGGCGCTGCTGGGGGCCTGG - Intronic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1184859098 22:47163160-47163182 GGGTGGGGCAGCCAGGGGCCGGG - Intronic
1185418031 22:50720632-50720654 GGCTGGCGCTGAAGGCGCCCAGG - Intergenic
949870234 3:8582104-8582126 GGGTGGCTCTGCTGGGGTCCCGG - Intergenic
950179536 3:10901430-10901452 GGGTTGCGCTGCGGGCGGTGAGG - Intronic
950263176 3:11556379-11556401 GGTCGGCGGTGCTGGCGGCCGGG - Exonic
950524810 3:13517526-13517548 GGGTGGGGCTGCCGGGGGCTGGG - Intergenic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
952852626 3:37741398-37741420 GGGTCGTGCTGTCGGCAGCCAGG - Intronic
952942304 3:38454095-38454117 GGGCGGCGCAGGCTGCGGCCCGG - Exonic
954814533 3:53270294-53270316 GTGTGGCACTGCCGTAGGCCTGG + Intergenic
955818864 3:62875084-62875106 GGGGGGCGCTGGAGGCAGCCGGG + Exonic
961404148 3:126666992-126667014 GGGAGGCGCAGCCAGCGGCAGGG + Intergenic
961551508 3:127672739-127672761 GGGCGGCGCTTCCTGCGCCCCGG + Exonic
961735744 3:129001387-129001409 TGGTGGCGCTGCCGGGGTCCCGG + Intronic
962259728 3:133895123-133895145 GTGCGGCGCTGCAGGGGGCCCGG - Intronic
963939565 3:151085894-151085916 GGCTGGGGCTGGCGGCGGCGGGG - Intronic
966806498 3:183811683-183811705 AGGTGGCGCTGCCAGGTGCCCGG + Exonic
966874651 3:184315103-184315125 GGGAGGCGGTGGCGGCGGGCAGG + Intronic
966881851 3:184355019-184355041 GGGTGGCGCTGTGGGCTGCCTGG - Intronic
967437229 3:189461764-189461786 GGGTGGCACTGCCAGAAGCCTGG - Intergenic
968189921 3:196660234-196660256 GGGCGGCGCTTTCGACGGCCTGG + Exonic
968196641 3:196712449-196712471 GGTAGGAGCTGCGGGCGGCCAGG + Exonic
968515154 4:1012592-1012614 GGGCGGCGCTGGCGGAGGCCAGG - Intronic
968701376 4:2059648-2059670 GGGGGGCGCGGCGGCCGGCCCGG - Exonic
968980909 4:3848899-3848921 GCGTGGAGCTGGCGGGGGCCAGG - Intergenic
969329201 4:6463367-6463389 GGGTGGGGCTGCAGGAGGCCAGG + Intronic
969413335 4:7043411-7043433 GGCTGGCTCTGGCGGCGGCTGGG + Exonic
969432864 4:7166116-7166138 GGGTGGCGGTCCCGGCTGCATGG + Intergenic
969521476 4:7680313-7680335 GAGAGGAGCTGCCGGCGGCTGGG - Intronic
969603268 4:8189391-8189413 GGCTGGCCGGGCCGGCGGCCGGG + Intronic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
972897199 4:43638128-43638150 TGGGGGCGCTGCAGGAGGCCAGG - Intergenic
973531864 4:51843422-51843444 CGGTGACGCTGCGGGCGGCGTGG + Intronic
977574073 4:98658696-98658718 GGGCGGAGCTGCGGGCGGCGCGG - Intergenic
979565715 4:122152383-122152405 GGGTGTCGGTGGCTGCGGCCAGG + Exonic
980328430 4:131379399-131379421 CGGTGGCGCTCCCGCCGGCGCGG + Intergenic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
981708367 4:147684438-147684460 GGGTGGCGCTTCGCGCTGCCTGG - Intergenic
985155924 4:186987225-186987247 GGGTGGAGCTGCCCAAGGCCAGG - Intergenic
985506827 5:286212-286234 GGGTGGTGCAGCTGGCGACCTGG + Intronic
985643484 5:1074394-1074416 GGATGGCGCAGCTGGGGGCCGGG - Intronic
985692131 5:1319360-1319382 GGGGGGGGCAGCCGGCGGCCAGG + Intronic
985936217 5:3100435-3100457 GGGTGGTGCTGCCGTGGGGCTGG - Intergenic
986329370 5:6706199-6706221 GGGTGGCGGTGCCTGCAGTCTGG + Intergenic
987181503 5:15372792-15372814 GGGTGGGGCTGAGGGTGGCCTGG + Intergenic
990381855 5:55227102-55227124 GGGCGGCGCGGCCGGCCGTCGGG - Exonic
991250783 5:64558873-64558895 TGGGGGCGCTGCAGGAGGCCAGG - Intronic
993411294 5:87576469-87576491 TGGGGGCGCTGCAGGAGGCCAGG - Intergenic
995650090 5:114361102-114361124 GGATGGCGCCCCCGGCCGCCGGG - Exonic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
999248197 5:150166722-150166744 GGCTGGGGCCGCGGGCGGCCCGG + Intergenic
999322613 5:150624744-150624766 CGGTGGCGGTGGCGGCGGCGAGG + Intronic
1000220447 5:159209257-159209279 GAGCGGCGCTGCCGGCGGGCGGG + Intronic
1001470224 5:172006626-172006648 GGGCGGAGCTGCCGGCGGCCCGG - Exonic
1002184305 5:177447086-177447108 GGGAGGGGCTGCTCGCGGCCCGG - Intronic
1002574059 5:180161603-180161625 GGGCGGCGCTGCAGGACGCCAGG + Intronic
1002579337 5:180198206-180198228 GGGTGGCGCTGTCTGGGGCTGGG - Intronic
1002580874 5:180208942-180208964 GGGGAGGGCTGCCGGCGGCGCGG - Intronic
1002792585 6:446940-446962 GGGGGGCGGTGCCCGCCGCCGGG + Intergenic
1003290608 6:4776088-4776110 GGGGGGCGGTGCCGCGGGCCAGG + Intronic
1005526800 6:26659441-26659463 GGGCGGCGCCGGCGGCTGCCAGG - Exonic
1007614287 6:43171384-43171406 GGGGGACGCTGACGGCCGCCCGG + Exonic
1007614300 6:43171429-43171451 AGGGGGCGCTGCGCGCGGCCTGG + Exonic
1007664187 6:43505012-43505034 GGGTGGGGCTGCCAGGGGCCGGG - Exonic
1010569965 6:77464126-77464148 GGGTGGCGGTGGCGGCGGCGCGG - Intergenic
1012912786 6:105136790-105136812 GGGCGGCGCCCCCGGCTGCCCGG + Intronic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1016923286 6:149317271-149317293 GGGTGCCGGTGCGGGCAGCCCGG - Intronic
1017810812 6:157982095-157982117 GGGCGTCGCTGCCCCCGGCCCGG - Intronic
1018059845 6:160081594-160081616 TGGGGGCGCTGCAGGAGGCCAGG + Intronic
1019343055 7:517548-517570 CGGCGGCGCTCCTGGCGGCCGGG - Intronic
1019409124 7:899004-899026 GGGGCGGGCGGCCGGCGGCCTGG - Intronic
1019529606 7:1496827-1496849 GGGTGGGGCTGCGGGCTGCCTGG - Intronic
1019769781 7:2876448-2876470 GCGGGGCGCTGCCTGAGGCCCGG + Intergenic
1020036235 7:4964800-4964822 GAGTGTCTTTGCCGGCGGCCTGG + Intergenic
1020418021 7:7968756-7968778 GGGAGGCGGTGCCGGGGGCGGGG + Intronic
1021313355 7:19117844-19117866 GGGTGGAGGGGCCGGCCGCCCGG - Intergenic
1022094573 7:27130625-27130647 GGGCGGCGCAGACGGCGGCCCGG - Exonic
1022410322 7:30134967-30134989 GAGTGGGGCGGGCGGCGGCCGGG - Exonic
1022443352 7:30451398-30451420 AGGTGGGGCAGCTGGCGGCCAGG - Exonic
1022943746 7:35262101-35262123 CGGTGTCGCTGGCGGCGGCGGGG + Intergenic
1023862709 7:44225680-44225702 GGGGGCTGCTGCAGGCGGCCAGG - Intronic
1024085566 7:45889084-45889106 GGGTGGGGCTGCAGCCGGGCAGG + Intronic
1024639353 7:51316835-51316857 GGGAGGGGCTGGCGGCGGCGCGG + Intergenic
1026665554 7:72337213-72337235 GTGTGGTGCTGTCGGCGGCAAGG - Intronic
1026909483 7:74083940-74083962 GGCTGGGGCTGGGGGCGGCCGGG - Exonic
1028762352 7:94509952-94509974 GGGAGGCGCAGGTGGCGGCCTGG + Exonic
1029372418 7:100158199-100158221 GGGCGGCGGCGCCGGCGACCAGG - Exonic
1029621403 7:101692082-101692104 GGGTGTCGCTGCCGCCCACCCGG + Intergenic
1032279172 7:130486951-130486973 TGGTGGCGCGGCTGGGGGCCTGG + Intronic
1033165607 7:139036133-139036155 GGGTGGGCCTGCGGGAGGCCGGG + Intergenic
1034137378 7:148783272-148783294 GCGTGGCGATGCCGGGGGCCAGG - Intronic
1034251281 7:149692780-149692802 GAGTGGCGGTGCCTGGGGCCCGG - Intergenic
1034977949 7:155458806-155458828 GAGAGTCGCTGCCGGCGGCTGGG - Exonic
1035169754 7:157010783-157010805 GGGCGGGGCGGCGGGCGGCCGGG - Intergenic
1035528929 8:336235-336257 GCCTGGGGCTGCCGGCTGCCAGG - Intergenic
1035619391 8:1026037-1026059 TGGTGGTGCTGGAGGCGGCCTGG - Intergenic
1035747780 8:1974162-1974184 GGGCAGCGCTGCCCGCGGCGGGG + Intronic
1036195295 8:6708552-6708574 GGGTGGCGGGCGCGGCGGCCCGG + Exonic
1036775941 8:11613271-11613293 GGGTGCCGGTGCCGGCTCCCGGG + Intergenic
1036910372 8:12754052-12754074 GGGAGGCCCTGCAGGCCGCCGGG - Intronic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1038477248 8:27876931-27876953 GGGTGGCTCTGCCTGCCGCCAGG + Intronic
1039531656 8:38268587-38268609 TGGTGGCGCTGCCTGGCGCCCGG - Intronic
1039892431 8:41694525-41694547 GGGTGGCCTTCCCGGAGGCCTGG + Intronic
1041690272 8:60680037-60680059 AGCTGCCGCCGCCGGCGGCCCGG - Intronic
1042785131 8:72537525-72537547 GGGTGGCTGTGGCGGCGGCAGGG + Exonic
1044819253 8:96144924-96144946 GTGCGCCGCCGCCGGCGGCCGGG + Exonic
1045148685 8:99378049-99378071 TGGGGGCGCTGCAGGAGGCCAGG + Intronic
1045260770 8:100571476-100571498 GGGTGGCTGTGCCGGTGGCAGGG + Intergenic
1047024546 8:120811786-120811808 GGCTGGCGCGGGAGGCGGCCGGG - Exonic
1049194740 8:141308790-141308812 GGGCTGGGCTGCCGGGGGCCGGG - Intergenic
1049277787 8:141728549-141728571 GGCTGGGGCTGCGGCCGGCCAGG - Intergenic
1049437760 8:142595576-142595598 GGGTGGGGGTGCAGGAGGCCAGG - Intergenic
1049457296 8:142700270-142700292 TGTTGGAGCGGCCGGCGGCCAGG - Exonic
1049463127 8:142739286-142739308 GGGTGGGGCTCGCGGAGGCCAGG - Intergenic
1049611317 8:143557014-143557036 AGATGGCGCTGCCGGTGCCCGGG - Intronic
1049617113 8:143580472-143580494 GGGTGGGGCTTCAGGGGGCCAGG - Intronic
1049674605 8:143884017-143884039 GGAGGGCACTGCCGGCTGCCCGG - Intergenic
1049797398 8:144503013-144503035 GGCTGGCTCTGCCTGGGGCCAGG + Intronic
1049896979 9:117802-117824 GGGGGGCTTTGCCGGCTGCCGGG + Exonic
1050091311 9:2017729-2017751 TGGCGGCGCGGCCGGCGGACGGG - Intronic
1050151257 9:2621727-2621749 GGGAGGCGCGGCGGGCGGGCGGG - Intergenic
1051774937 9:20622649-20622671 GTGTGGCGCTGCGGGCCGCCGGG - Intergenic
1051780561 9:20684349-20684371 GGGTCGCGCCGCCTGCGGCCCGG + Intronic
1053230204 9:36401215-36401237 GGGCGGGGCTGCGCGCGGCCCGG + Intronic
1053740079 9:41128054-41128076 GGGGGGCTTTGCCGGCTGCCGGG + Exonic
1054443043 9:65284048-65284070 GGGGGGCTTTGCCGGCTGCCGGG + Exonic
1054487237 9:65737453-65737475 GGGGGGCTTTGCCGGCTGCCGGG - Exonic
1054688271 9:68303259-68303281 GGGGGGCTTTGCCGGCTGCCGGG - Exonic
1057076618 9:92141494-92141516 GGGGGGCGCAGCCGGCGCTCGGG - Intergenic
1057596582 9:96419359-96419381 GGCTGGCGCCGACCGCGGCCCGG + Intergenic
1057682249 9:97199846-97199868 GGGCGGCGCCGGCGGCTGCCAGG - Intergenic
1057792486 9:98133319-98133341 GGGTGGCGCAGCTGGCAGCCTGG + Intronic
1058908188 9:109498159-109498181 GTGCGGGGCTGCCGGGGGCCGGG - Intronic
1060481254 9:124017892-124017914 GGGAGGGGCTGCCAGCGGGCTGG + Intronic
1060776819 9:126380658-126380680 AGGGGGCGCTGCCTGCGGCGAGG - Intronic
1061326556 9:129868075-129868097 CGGTGGCGCTGACGGAGGCTCGG + Exonic
1061783282 9:133008173-133008195 GGGGGGCACTGCCAGTGGCCAGG + Intergenic
1061808460 9:133149144-133149166 GAGCGGCGCTGGCGGCTGCCGGG - Intronic
1061858632 9:133456641-133456663 AGGCAGCGCTGCGGGCGGCCAGG + Exonic
1062389550 9:136328420-136328442 GTGTGGCTCTGCCTGAGGCCTGG - Intronic
1062463944 9:136673033-136673055 GGGTGGCGGTGCCTGCACCCTGG + Intergenic
1062465532 9:136679275-136679297 AGGTGGTGCTGCCGCAGGCCTGG - Intronic
1062524494 9:136972766-136972788 GGGTGGGGCTGCCAAGGGCCGGG - Intergenic
1185747551 X:2584452-2584474 GGGGGGCCCTGGGGGCGGCCGGG + Intergenic
1186898617 X:14030066-14030088 GGGTGGCGGGGCCGGCGGAGAGG + Intergenic
1186994539 X:15105926-15105948 TGGGGGCGCTGCAGGAGGCCAGG + Intergenic
1187464409 X:19515024-19515046 GGGCGGCGCGGCCGGCGGCCCGG - Exonic
1191721995 X:64238885-64238907 TGGGGGCGCTGCAGGAGGCCAGG + Intergenic
1191898601 X:66018870-66018892 GCGTGGCACTGCAGGAGGCCAGG - Intergenic
1192260680 X:69504560-69504582 CTGTGGCGCTGCCGGGAGCCAGG + Intergenic
1192473733 X:71420948-71420970 GGCTGGGGCTGCAGGCGGTCAGG - Intronic
1197648676 X:129042360-129042382 GGGTGGGGCTGCCAGGGGCCGGG + Intergenic
1198767141 X:140091489-140091511 GGGTGGCTGAGCCGGCGGGCGGG + Intergenic
1198994717 X:142561173-142561195 TGGGGGCGCTGCAGGAGGCCAGG - Intergenic
1199569659 X:149254740-149254762 AGGTGGCACTGCCAGCTGCCTGG - Intergenic
1201177920 Y:11321311-11321333 GGGCGTCGCGGCCTGCGGCCGGG - Intergenic