ID: 952452862

View in Genome Browser
Species Human (GRCh38)
Location 3:33448044-33448066
Sequence TGTCCTCCTGGACCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952452862_952452867 15 Left 952452862 3:33448044-33448066 CCTCCTTGTGGTCCAGGAGGACA No data
Right 952452867 3:33448082-33448104 TTTCGAGAATGCGTCAGTAAGGG 0: 11
1: 50
2: 145
3: 114
4: 145
952452862_952452866 14 Left 952452862 3:33448044-33448066 CCTCCTTGTGGTCCAGGAGGACA No data
Right 952452866 3:33448081-33448103 TTTTCGAGAATGCGTCAGTAAGG 0: 12
1: 62
2: 141
3: 130
4: 172
952452862_952452865 -9 Left 952452862 3:33448044-33448066 CCTCCTTGTGGTCCAGGAGGACA No data
Right 952452865 3:33448058-33448080 AGGAGGACATGCAAGCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952452862 Original CRISPR TGTCCTCCTGGACCACAAGG AGG (reversed) Intergenic
No off target data available for this crispr