ID: 952452980

View in Genome Browser
Species Human (GRCh38)
Location 3:33448799-33448821
Sequence GGGCCATAACCAATAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952452980_952452983 -6 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452983 3:33448816-33448838 TGGCCCCTTCAAGCTGTACAGGG No data
952452980_952452992 17 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452992 3:33448839-33448861 AGGGGAATTTGGCCCAACCCGGG 0: 77
1: 80
2: 52
3: 31
4: 100
952452980_952452990 6 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452990 3:33448828-33448850 GCTGTACAGGGAGGGGAATTTGG No data
952452980_952452989 -1 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452989 3:33448821-33448843 CCTTCAAGCTGTACAGGGAGGGG No data
952452980_952452991 16 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452991 3:33448838-33448860 GAGGGGAATTTGGCCCAACCCGG 0: 86
1: 56
2: 32
3: 10
4: 109
952452980_952452982 -7 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452982 3:33448815-33448837 ATGGCCCCTTCAAGCTGTACAGG No data
952452980_952452987 -2 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452987 3:33448820-33448842 CCCTTCAAGCTGTACAGGGAGGG No data
952452980_952452985 -3 Left 952452980 3:33448799-33448821 CCCTGGGCTATTGGTTATGGCCC No data
Right 952452985 3:33448819-33448841 CCCCTTCAAGCTGTACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952452980 Original CRISPR GGGCCATAACCAATAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr