ID: 952455169

View in Genome Browser
Species Human (GRCh38)
Location 3:33465906-33465928
Sequence CACAACAGGGTGCAACCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952455162_952455169 -6 Left 952455162 3:33465889-33465911 CCCTGAGTCCTGGCGACCACAAC No data
Right 952455169 3:33465906-33465928 CACAACAGGGTGCAACCCATGGG No data
952455163_952455169 -7 Left 952455163 3:33465890-33465912 CCTGAGTCCTGGCGACCACAACA No data
Right 952455169 3:33465906-33465928 CACAACAGGGTGCAACCCATGGG No data
952455161_952455169 2 Left 952455161 3:33465881-33465903 CCTTATATCCCTGAGTCCTGGCG No data
Right 952455169 3:33465906-33465928 CACAACAGGGTGCAACCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952455169 Original CRISPR CACAACAGGGTGCAACCCAT GGG Intergenic
No off target data available for this crispr