ID: 952455238

View in Genome Browser
Species Human (GRCh38)
Location 3:33466379-33466401
Sequence GAGAAGCCCCTGTACTCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952455235_952455238 3 Left 952455235 3:33466353-33466375 CCTTTCAAGAAAAAGCCTCTGGC No data
Right 952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG No data
952455232_952455238 19 Left 952455232 3:33466337-33466359 CCAGCCTAGTAAAACGCCTTTCA No data
Right 952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG No data
952455233_952455238 15 Left 952455233 3:33466341-33466363 CCTAGTAAAACGCCTTTCAAGAA No data
Right 952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG No data
952455231_952455238 20 Left 952455231 3:33466336-33466358 CCCAGCCTAGTAAAACGCCTTTC No data
Right 952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952455238 Original CRISPR GAGAAGCCCCTGTACTCGCA GGG Intergenic
No off target data available for this crispr