ID: 952457980

View in Genome Browser
Species Human (GRCh38)
Location 3:33492200-33492222
Sequence TGAACGACTTTGGGGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952457980_952457985 -4 Left 952457980 3:33492200-33492222 CCAGCCAACCCCAAAGTCGTTCA No data
Right 952457985 3:33492219-33492241 TTCACTGCTGCTAACCTGCTTGG No data
952457980_952457987 15 Left 952457980 3:33492200-33492222 CCAGCCAACCCCAAAGTCGTTCA No data
Right 952457987 3:33492238-33492260 TTGGAGTAAACCTCACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952457980 Original CRISPR TGAACGACTTTGGGGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr