ID: 952467262

View in Genome Browser
Species Human (GRCh38)
Location 3:33602649-33602671
Sequence GTTTCTAAGGGGGTTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952467262_952467270 -7 Left 952467262 3:33602649-33602671 CCTTCCCAAACCCCCTTAGAAAC 0: 1
1: 0
2: 1
3: 16
4: 200
Right 952467270 3:33602665-33602687 TAGAAACCAGTGGCTAGATGTGG 0: 1
1: 0
2: 0
3: 12
4: 200
952467262_952467272 22 Left 952467262 3:33602649-33602671 CCTTCCCAAACCCCCTTAGAAAC 0: 1
1: 0
2: 1
3: 16
4: 200
Right 952467272 3:33602694-33602716 TGCAGTTATGAAAATTCTACAGG 0: 1
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952467262 Original CRISPR GTTTCTAAGGGGGTTTGGGA AGG (reversed) Intronic
900934772 1:5758367-5758389 GTTTCTCAGGTGGCTTGGGCCGG - Intergenic
902681790 1:18048883-18048905 GTTTATGAGGGCTTTTGGGAAGG - Intergenic
902763908 1:18602078-18602100 GAGTCTCAGGGGGTTTGAGATGG - Intergenic
906782593 1:48585805-48585827 GTTTGTATGTGTGTTTGGGAGGG - Intronic
906982598 1:50647906-50647928 ATTTCTAAGAGGGTTGGAGAAGG + Intronic
908328894 1:63051078-63051100 GTGTGTACGGGGGTTGGGGACGG + Intergenic
908912601 1:69089474-69089496 GTTTTTTAGGGGGATGGGGAAGG + Intergenic
909042992 1:70675917-70675939 GTTCCTGAGGGGGTATGTGACGG + Intergenic
910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG + Intergenic
912586656 1:110772599-110772621 CTTTATAAGGGGCATTGGGAAGG - Intergenic
912734746 1:112140286-112140308 GTCTCTATGGTGGTTTGGGAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915621694 1:157090127-157090149 TTTGCTAAGGGGGTTTGAAATGG + Intergenic
916457772 1:164988574-164988596 ATTTCAAAGGAGGTCTGGGAAGG - Intergenic
919474449 1:198017217-198017239 GTCTCTAAGGGTGTTTCTGAAGG - Intergenic
920342521 1:205284454-205284476 GTTTGGAAGGAGGTTTAGGAAGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1063151456 10:3340303-3340325 GTTTCTAAGACGGTGTGGGGAGG + Intergenic
1063350602 10:5351110-5351132 CTTTCTAAGTGGGGTTGGGTGGG - Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1066046223 10:31597859-31597881 GTTTCAAATTGGGTTTGTGAAGG + Intergenic
1066370023 10:34812833-34812855 TTTTTTAAGGGTGTCTGGGAAGG - Intronic
1068343711 10:55742646-55742668 GTTTCAAAGTGAGTTTTGGAGGG + Intergenic
1068796541 10:61088166-61088188 GTTGCTAAGGAGGTTTGGAACGG + Intergenic
1069855550 10:71439066-71439088 ATTTCTAAGGGTGGCTGGGAGGG - Intronic
1071054651 10:81495028-81495050 GTTTATGAAGGAGTTTGGGAAGG + Intergenic
1071310233 10:84336441-84336463 TTATCTAAGGTGGTTAGGGAAGG + Intronic
1072844009 10:98808232-98808254 GTTTCTGAGAGGGTTTGAGGGGG - Intronic
1073025057 10:100481826-100481848 GTTTCTAATTGGGTTGGGGGTGG - Intronic
1074256891 10:111811950-111811972 ATATCTAAGGAGGCTTGGGAGGG - Intergenic
1075205450 10:120444004-120444026 GTTTCTAAGGGGTTGTGGCCCGG - Intergenic
1076292649 10:129359597-129359619 GATTCTAAGGGGGATAGAGAGGG + Intergenic
1076667101 10:132099550-132099572 CTGTCTACGGGGGTTTGGGGAGG + Intergenic
1078505788 11:11943519-11943541 CTTTTTAAGGGGGTATGGCAAGG - Intronic
1079249438 11:18776369-18776391 CTTCCTAAGGGAGTTGGGGAGGG - Intronic
1081035367 11:38137454-38137476 TTTACTAAGCGGCTTTGGGAAGG - Intergenic
1084869885 11:72091299-72091321 GGTTCTAAGGAGGTATGGGGAGG + Intronic
1086134489 11:83432686-83432708 GTTTCAATGGGGGAGTGGGAGGG + Intergenic
1088024385 11:105160087-105160109 GTGTCTAAGGTAGTTTGTGATGG + Intergenic
1089129634 11:116201614-116201636 TTTTCCAAGGAGGTTTGGGAAGG - Intergenic
1089345234 11:117786834-117786856 GTCTCTGAGGGGGTGTGGCAGGG - Intronic
1089668927 11:120039011-120039033 GTTTCTAAGGGTGGTGGGGGTGG - Intergenic
1097102198 12:56597758-56597780 GTTCCCAAGAGGGTTTGGGAAGG + Exonic
1098055873 12:66504463-66504485 GTCTCTAAGTGGGTGTGGGATGG + Intronic
1101014582 12:100486577-100486599 GTTTCTTTGGGAGTTTGAGACGG - Intronic
1102165443 12:110802547-110802569 GTGTATAAGGGGGTCTGGGGAGG + Intergenic
1102781538 12:115570113-115570135 GTATTTAAGCGGGTTTGGGCTGG - Intergenic
1106895755 13:34300518-34300540 GTTTATAAGGGGGATTAGGAAGG + Intergenic
1108882792 13:55141981-55142003 GTTTCTGAGTGTGTTTGTGAAGG + Intergenic
1109710848 13:66157526-66157548 GTTTCTAAGAGGGTTGGGAAAGG + Intergenic
1111216517 13:85149780-85149802 GTTTCTAGGGGGGCTGAGGAAGG - Intergenic
1117440201 14:55752601-55752623 CTATCAAAGGGGGTTTGGCATGG - Intergenic
1120363791 14:83540552-83540574 CTTTCTAAGGTGGTTTGCCATGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128749669 15:70140049-70140071 GTTTCTAGGAGGGTTTGGTCTGG - Intergenic
1129355935 15:74991806-74991828 GTGGCTAAAGGGGTATGGGAAGG - Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131446569 15:92502990-92503012 GTTTCTAAGGGGCAAAGGGATGG + Intergenic
1131844378 15:96472984-96473006 GTGTCTAAGTGGGTTTGTAATGG + Intergenic
1134396389 16:13868249-13868271 GTTTCTCAGGGGTTTGAGGAAGG - Intergenic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1136514845 16:30761930-30761952 GTTGCCAAGGGGGCTTGTGAGGG + Exonic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1139470698 16:67176692-67176714 GTTTCTTGGGGGTGTTGGGAGGG - Exonic
1139822650 16:69732517-69732539 GTTTCTAGGTGTGTCTGGGAGGG - Intergenic
1141646728 16:85371544-85371566 GATTCTAAGGGGGCGTGGCAGGG + Intergenic
1144853687 17:18256890-18256912 GCTGGTAAGGGGGTTTGGGCGGG - Exonic
1145736004 17:27232116-27232138 ATTTCCAACGGAGTTTGGGATGG - Intergenic
1146971228 17:37074065-37074087 TTTTCTAAGAGAGTTTGAGAAGG + Intergenic
1147663101 17:42128176-42128198 GATGCTCAGGGGCTTTGGGAAGG - Intronic
1148154021 17:45412418-45412440 CTTCCTATGAGGGTTTGGGAGGG - Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1150263050 17:63812330-63812352 GCTTCCTTGGGGGTTTGGGAGGG - Intronic
1151155792 17:72122370-72122392 TTTTCAAAGGGGGTTGGGGTTGG + Intronic
1152135283 17:78499937-78499959 GTGTCCAGGTGGGTTTGGGAGGG - Intronic
1152285221 17:79408587-79408609 GTTGCTAAGGGGGTGCTGGATGG + Intronic
1154087370 18:11320513-11320535 GTTTCAAAGGGTGAATGGGATGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159136055 18:64338022-64338044 GTTTCTCTGGTGGTTTGGAATGG + Intergenic
1159448975 18:68575984-68576006 GTGTGTAGGGGGGTGTGGGAGGG - Intergenic
1160319080 18:77873539-77873561 GTTTCTCAGTGTGTCTGGGAGGG + Intergenic
1161218123 19:3104880-3104902 GGTTCTCCGGGCGTTTGGGAAGG + Intronic
1162355398 19:10180392-10180414 GTTTGGAAAGGGGTTTGGGGGGG + Exonic
1164425771 19:28140234-28140256 GTTTCTCAGGGGGTAGGGAAAGG - Intergenic
1164836327 19:31357325-31357347 GGATGCAAGGGGGTTTGGGAGGG + Intergenic
1165462248 19:35950914-35950936 GTTTCTAACTGGGCCTGGGATGG + Intergenic
1166203528 19:41253840-41253862 GTCAGTAAGGGGGTCTGGGAAGG + Intronic
1167278766 19:48554271-48554293 GTATCTGAGGGGGTCTGGGAGGG - Intronic
1168398869 19:56071582-56071604 GTTTCTGAGTGTGTCTGGGAGGG + Intergenic
1168679277 19:58301763-58301785 TTCTCAAAGGGGGTGTGGGAAGG + Exonic
925940091 2:8808898-8808920 TTTTTTAGGGGGGTTTGGTAAGG - Intronic
926429844 2:12774568-12774590 ATTTCAAGGGGGGTTGGGGAGGG - Intergenic
928146638 2:28784433-28784455 TTTTTCAAGGGGGTGTGGGAGGG + Intronic
929223307 2:39487420-39487442 GATTCTAAGGGGGCTTGAAAAGG + Intergenic
931238228 2:60429796-60429818 GTTTCTCATAGGGTTTTGGATGG - Intergenic
931329109 2:61261485-61261507 GGTTGCAAGGGGGGTTGGGAGGG + Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
933247880 2:79995962-79995984 GTTTCCAAGAGGGTTGGGCATGG - Intronic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
948986859 2:241530888-241530910 GTTTCTGAGGGTGTCTGTGAAGG - Intergenic
1169241157 20:3982239-3982261 GTTTCAAGAGGAGTTTGGGAGGG - Intronic
1172160764 20:32866525-32866547 GCTTCTGGGGGGATTTGGGAAGG + Intronic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1174983506 20:55423348-55423370 CTTTCAAAGGGGTTTTGTGATGG - Intergenic
1178032245 21:28541416-28541438 GTTACTATGATGGTTTGGGAGGG - Intergenic
1178266991 21:31152511-31152533 GTTCCTAAGGGTGTCTGAGAGGG - Intronic
1180246380 21:46550716-46550738 GTTTCTGACGAGGTTTGGGGAGG - Exonic
1182585694 22:31343325-31343347 GTTTCTAAGGGGCTTTAGTCTGG - Intronic
1183326419 22:37197105-37197127 GATTCCAAGTCGGTTTGGGAGGG - Intronic
1183393027 22:37556651-37556673 GGTTCCAGGGAGGTTTGGGATGG - Intergenic
1183510472 22:38231649-38231671 GGTACTCAGGAGGTTTGGGAGGG + Intronic
1183698743 22:39437999-39438021 TGTTTTAAGGGGGTTTGAGAAGG - Intergenic
1184420546 22:44380496-44380518 GTTTCTAGGGTGGTCTGGGAGGG + Intergenic
1185015700 22:48341332-48341354 GTTTCTGAAGGCGTTAGGGAGGG - Intergenic
949981288 3:9503262-9503284 GTTGTTAGGGGGCTTTGGGAAGG + Intronic
950391603 3:12701156-12701178 GTTTCTAAGGGGTTTGGAGTGGG + Intergenic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
953669369 3:44949758-44949780 ATTTCCAAGGGGGCCTGGGAAGG + Intronic
954224182 3:49172006-49172028 GCTTCTGGGGGGGTTTGGAATGG + Intronic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
957841488 3:85676295-85676317 TTTTCTATTTGGGTTTGGGAGGG - Intronic
958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG + Intergenic
960056898 3:113282341-113282363 TTTTCTAAGGAGGTGTGGGCGGG + Intronic
960740058 3:120823572-120823594 TTATGTAAGGTGGTTTGGGAAGG - Intergenic
962805221 3:138922313-138922335 GTGTCTGAGGGGACTTGGGAAGG - Intergenic
962881989 3:139586974-139586996 ATTTGTATTGGGGTTTGGGAGGG + Intronic
963282465 3:143398154-143398176 GTTTCTAAGATGTTTTGAGAAGG + Intronic
963724777 3:148907927-148907949 GGGTCTAACGGTGTTTGGGAGGG - Intergenic
968749284 4:2378901-2378923 GAGTCTAAGGTGGTTTGGGAAGG - Intronic
969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG + Intergenic
970434304 4:16018601-16018623 GTGTCTAAAGGGACTTGGGATGG + Intronic
973112660 4:46414482-46414504 GTTTCTAAGGGTGTTGGAGTGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
976380284 4:84391004-84391026 ATTCCTCAGGGGGTTAGGGAGGG + Intergenic
977016670 4:91700027-91700049 GTTTCTAATGGGGCCTGAGACGG + Intergenic
977053709 4:92162914-92162936 GTATCAAAGAGGGTTTGGGTGGG - Intergenic
977861348 4:101964364-101964386 GTTTCTGTGGGGCTGTGGGATGG - Intronic
981157504 4:141456826-141456848 GTTTCTAAGAGGAGTTGGGCAGG + Intergenic
981685445 4:147449486-147449508 TTTTCAAGTGGGGTTTGGGAAGG - Intergenic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
982473782 4:155825886-155825908 CTTTCCAAGGATGTTTGGGAAGG + Intergenic
984008564 4:174343148-174343170 GTTGCCAAGGGGTTTGGGGAAGG - Intergenic
984537639 4:180996896-180996918 TTTTCTAAGGGGTTCAGGGAAGG + Intergenic
985701128 5:1373473-1373495 GGTTGTAATGGGGTTTGTGAAGG + Intergenic
987257864 5:16175312-16175334 ATCTCTAAGATGGTTTGGGAAGG - Intronic
988616607 5:32781115-32781137 TTTTCTGAGGGGGAGTGGGAGGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992793318 5:80232955-80232977 GGCTCTGAGGGAGTTTGGGAGGG + Intronic
994160073 5:96547580-96547602 GTTTCTAAGTGTGTCTGTGAGGG - Intronic
994825902 5:104712653-104712675 GTTTCCACTGGGGTTTGGGATGG - Intergenic
995835341 5:116395071-116395093 GTTTCTAAAGGGGTTGGGGTGGG - Intronic
996217939 5:120891888-120891910 GTTTCCAAGGGGGTTAGTGCAGG - Intergenic
996274806 5:121651863-121651885 ATTTCTAAAGGGGGTAGGGATGG + Intergenic
998977394 5:147663234-147663256 GTTTCTGAGTGTGTTTGTGAGGG + Intronic
1000742742 5:164990234-164990256 CTTTTTAAGGGGGATAGGGATGG - Intergenic
1001313314 5:170626392-170626414 CTTTCTAATGGGGGTGGGGAAGG + Intronic
1002123808 5:177026318-177026340 GTTTCTGAAGGAGTTTGTGAAGG + Intronic
1006745741 6:36340836-36340858 GGTTCTGACGGGGCTTGGGAAGG - Intergenic
1007828951 6:44623661-44623683 GTTTCTAAGAGGGTGTGGCAGGG + Intergenic
1008130804 6:47718829-47718851 ATTCCTAAGGGGGTATGGGTGGG + Intronic
1010717722 6:79248835-79248857 ATATCTAAGGGGGTTAGGAATGG - Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1017034356 6:150253593-150253615 GTTTCTGAGTGGGGTTGGGTGGG - Intergenic
1017923220 6:158888881-158888903 GGTTCTTAGAGGTTTTGGGATGG + Intronic
1019706073 7:2497913-2497935 CTGTCAAAGCGGGTTTGGGATGG + Intergenic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1025975174 7:66363943-66363965 GTAACTAAGGGGGTTGGGGGGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028716808 7:93980220-93980242 TTTTCTGAGGGAGTTTGAGAAGG - Intronic
1028932047 7:96424013-96424035 CCTTCTAAGGTGATTTGGGAGGG + Intergenic
1029379529 7:100203915-100203937 CTACCTAAGGGAGTTTGGGAGGG + Intronic
1031193909 7:118588598-118588620 GTTTGGAAGGGGGATTGTGATGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033981800 7:147174226-147174248 ATATGTAAGGGAGTTTGGGAGGG - Intronic
1034542593 7:151768361-151768383 GTTGCTAATGGGGTTTTGGTGGG - Intronic
1034915321 7:155033995-155034017 GATTCTAAGTGGATTTGGGCAGG + Intergenic
1037772762 8:21812110-21812132 GTCTCCAAGGTGGTTTCGGATGG - Intronic
1038142143 8:24857560-24857582 TTTTCTCAGGAGCTTTGGGAAGG - Intergenic
1038411479 8:27362661-27362683 GCTACAAAGGGGGTTTGGCAAGG - Intronic
1038714679 8:29981094-29981116 GATTCTGAGGGGGCTGGGGAAGG + Intergenic
1039059736 8:33564179-33564201 GTTTCTGAAGGGGTGAGGGAAGG + Intronic
1039433744 8:37545586-37545608 GTTTCTCAGGGCCTGTGGGAGGG - Intergenic
1044280927 8:90355100-90355122 GTTTCACAGGGAGATTGGGAAGG + Intergenic
1045243518 8:100422889-100422911 GTGGCTAAGGGGGCTTGGGGTGG + Intergenic
1045968336 8:108051877-108051899 GTTTCTTAAGGGGTTTGGCATGG + Intronic
1045996348 8:108366852-108366874 GCATCTAAGGGGGATAGGGAGGG - Intronic
1046207692 8:111023002-111023024 GTTTTTCAGGTGGTTTGAGAGGG + Intergenic
1048945489 8:139443310-139443332 GTTTCCAACGGGGTGGGGGAGGG - Intergenic
1049037182 8:140085921-140085943 ATTCCTAAGGGGGTGTGGGGTGG - Intronic
1049097377 8:140557046-140557068 GTGTCTCTGGGGGCTTGGGAGGG - Intronic
1049490257 8:142894851-142894873 GTTACTCAGGGGGTTAGGGGTGG - Intronic
1050821229 9:9882718-9882740 GTGTATAGGGGGGTTGGGGAGGG - Intronic
1051140859 9:13977665-13977687 ATTTATAAGGTGGTTGGGGACGG + Intergenic
1052403192 9:28026470-28026492 ATTTCTAAGGCGTTCTGGGATGG + Intronic
1053162919 9:35825956-35825978 GCCTCTAAGGGGATCTGGGAAGG + Exonic
1053581627 9:39410670-39410692 GTTTCTAAGGGCCTTTGTTAAGG + Intergenic
1053846052 9:42238003-42238025 GTTTCTAAGGGCCTTTGTTAAGG + Intergenic
1054103207 9:60969402-60969424 GTTTCTAAGGGCCTTTGTTAAGG + Intergenic
1054583148 9:66937435-66937457 GTTTCTAAGGGCCTTTGTTAAGG - Intergenic
1054840487 9:69733213-69733235 GTGTGTATGGGGGTTTGGAAAGG - Intronic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057839976 9:98478466-98478488 GTTTCTCAGAGGCTTTGGGCTGG - Intronic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1059563314 9:115356556-115356578 GTTTGTAAGGTGTGTTGGGAAGG + Intronic
1187151287 X:16684152-16684174 TTTTCTAAGGTGTTTGGGGAAGG - Intronic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1190455938 X:50627946-50627968 GTTTTTAATGTGGTTTGGGAGGG - Intronic
1191149691 X:57207927-57207949 GTTTGGAATGGGGTCTGGGACGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1195004081 X:100669604-100669626 ATTCCTAAGGTGGTTTAGGATGG - Intronic
1195783865 X:108495506-108495528 TTTTCTAATGGGATTTGGGGGGG - Intronic
1199080645 X:143572977-143572999 ATTTTGAAGGGGTTTTGGGATGG - Intergenic
1201926663 Y:19294988-19295010 GTTTGGAATGGGGTCTGGGATGG - Intergenic