ID: 952467876

View in Genome Browser
Species Human (GRCh38)
Location 3:33610351-33610373
Sequence GTTTCAGTGGGAAAAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 414}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952467876_952467883 8 Left 952467876 3:33610351-33610373 CCACCTTCTTTTCCCACTGAAAC 0: 1
1: 0
2: 2
3: 31
4: 414
Right 952467883 3:33610382-33610404 TATCATATGTTCTGGCCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 129
952467876_952467884 9 Left 952467876 3:33610351-33610373 CCACCTTCTTTTCCCACTGAAAC 0: 1
1: 0
2: 2
3: 31
4: 414
Right 952467884 3:33610383-33610405 ATCATATGTTCTGGCCTCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 135
952467876_952467885 21 Left 952467876 3:33610351-33610373 CCACCTTCTTTTCCCACTGAAAC 0: 1
1: 0
2: 2
3: 31
4: 414
Right 952467885 3:33610395-33610417 GGCCTCAGGGGCCTATCTGATGG 0: 1
1: 0
2: 2
3: 23
4: 202
952467876_952467882 7 Left 952467876 3:33610351-33610373 CCACCTTCTTTTCCCACTGAAAC 0: 1
1: 0
2: 2
3: 31
4: 414
Right 952467882 3:33610381-33610403 TTATCATATGTTCTGGCCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 146
952467876_952467881 0 Left 952467876 3:33610351-33610373 CCACCTTCTTTTCCCACTGAAAC 0: 1
1: 0
2: 2
3: 31
4: 414
Right 952467881 3:33610374-33610396 CTTTCATTTATCATATGTTCTGG 0: 1
1: 0
2: 1
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952467876 Original CRISPR GTTTCAGTGGGAAAAGAAGG TGG (reversed) Intronic
900326576 1:2111221-2111243 GGTGCTGTGGGAAAAGAAAGAGG + Intronic
900631642 1:3639566-3639588 GTCTCAGTGGGAAATGCAGGTGG - Intronic
903597565 1:24507302-24507324 ATTTCAGGAGGAAAAGAATGGGG - Intronic
903790015 1:25886380-25886402 GCTTCATTTGGAAAAGGAGGAGG + Intronic
904437588 1:30508650-30508672 GTGTCAGCGGGAAAAGCTGGGGG - Intergenic
904581537 1:31547696-31547718 GTTTCAGTGGCAAGGGCAGGTGG + Intergenic
904839366 1:33362034-33362056 GTTACAGTGGGAAAAGCAGTGGG - Intronic
904921999 1:34015170-34015192 TTTTCAGCAGGAAAAGAATGTGG - Intronic
904989941 1:34584400-34584422 GTTTTGCTGTGAAAAGAAGGAGG + Intergenic
906220195 1:44072245-44072267 GTTTGGGTGGGAAGACAAGGAGG + Intergenic
908092620 1:60701867-60701889 TTTTCAGTTAGAAAAAAAGGTGG - Intergenic
908642491 1:66240853-66240875 ATTTCTGTGGGAAAAGACTGAGG + Intronic
909483081 1:76146505-76146527 GTGTGAGGGAGAAAAGAAGGAGG - Intronic
909668965 1:78166843-78166865 GTTTTCCTGGGAAAGGAAGGAGG - Intergenic
910037052 1:82801168-82801190 CTTTCAGTGGGTGGAGAAGGGGG + Intergenic
910848933 1:91632167-91632189 GCCTCAGTGGGACAGGAAGGTGG + Intergenic
913141440 1:115945221-115945243 GTTTGAGTGGGAAAAGCCAGAGG + Intergenic
913356489 1:117928908-117928930 GTCTCAGTGAGCAAACAAGGAGG + Intronic
913389682 1:118296734-118296756 GCTTCAGTAGAAAAAGGAGGTGG - Intergenic
914666630 1:149838186-149838208 GTTGCAGGGAGAAAAGAAGATGG + Intergenic
914669137 1:149855610-149855632 GTTGCAGGGAGAAAAGAAGATGG - Intronic
914878846 1:151532395-151532417 GTTTCAGTTGGAGAAGATCGGGG + Exonic
915812945 1:158935394-158935416 ATTTCAGTGGGATAAAAATGTGG + Intronic
917106062 1:171493128-171493150 ATTTCAGTGGTAGAAGAAGAGGG + Intronic
917139907 1:171825422-171825444 GTTGCACTGGGAATAGTAGGAGG + Intergenic
917268453 1:173246993-173247015 GATTCCCTGGGAAAAGAAGGAGG - Intergenic
918301983 1:183212954-183212976 GTCTGAGTGAGAAGAGAAGGAGG - Intronic
920314596 1:205068337-205068359 GTTTCAGGCAGACAAGAAGGTGG - Intronic
920703945 1:208238241-208238263 CTTTCAGAGGGAAGAGGAGGAGG - Intronic
921458163 1:215396569-215396591 GTTTGAGTGGGCCAAGGAGGAGG + Intergenic
921807208 1:219469697-219469719 ATTGCTGTGGGAGAAGAAGGAGG - Intergenic
922368827 1:224889894-224889916 GTTTCAGTGGGAGAATATGTGGG - Intergenic
923424001 1:233850183-233850205 GTTGCAGAGGAATAAGAAGGGGG + Intergenic
923541030 1:234888329-234888351 GTTTAAGATGGCAAAGAAGGAGG + Intergenic
924616727 1:245618051-245618073 GTTACAGAAGGAAGAGAAGGAGG + Intronic
924875148 1:248095229-248095251 GTTTCAGTGAGAACAGAATAAGG - Intronic
1062997609 10:1881687-1881709 GTTTCTGTGGAAAAGGAAGAGGG + Intergenic
1064586276 10:16842599-16842621 GTTTCAGTGGGAACAGGTGAAGG - Intronic
1068361084 10:55975568-55975590 GTTTCAGTGGGAGAGTAAGTGGG - Intergenic
1068405755 10:56586314-56586336 ATCTCAGTGGGAAAAGAATATGG - Intergenic
1070509470 10:77147430-77147452 CTTTCAGGGGGAAGGGAAGGAGG - Intronic
1070607441 10:77908682-77908704 GTTTCAGTGCCTAAGGAAGGAGG - Intronic
1071855053 10:89615681-89615703 GTTTAAGTGGCAAAAGAAATTGG + Intronic
1072195500 10:93114448-93114470 GTTTCAATGGGAGAAAGAGGAGG - Intergenic
1072429164 10:95355942-95355964 TTTTCAGCCGGAAAGGAAGGGGG + Intronic
1073025253 10:100482829-100482851 GAACCAGTGGGAAAAGGAGGGGG - Exonic
1073034455 10:100553573-100553595 TTTTCAGTGGGAAAGCAGGGGGG - Exonic
1073036927 10:100570313-100570335 GTTTTAGTGGGAGAGGGAGGTGG - Intergenic
1074036314 10:109742377-109742399 GTTGCAGTGGGAAGCGGAGGCGG + Intergenic
1074568866 10:114606618-114606640 GGTGCAGTGGGGAAGGAAGGGGG - Intronic
1075227821 10:120645401-120645423 GTTTCCGTGGAAAACCAAGGTGG - Intergenic
1075350571 10:121721040-121721062 TTTTCAGTGGAAAAAAAAGTTGG - Intergenic
1075537804 10:123285717-123285739 GTCTCGGTGAGAAGAGAAGGAGG - Intergenic
1076673657 10:132136640-132136662 AATTCAGTGTGAAAAGAAGGGGG - Intronic
1078437381 11:11336718-11336740 AGGTCAGTTGGAAAAGAAGGAGG - Intronic
1078609287 11:12806211-12806233 GCTGGAGTGGGAAGAGAAGGGGG - Intronic
1079335331 11:19565647-19565669 ATTTCTGTGGAAAAAAAAGGCGG - Intronic
1079459585 11:20668648-20668670 GTGGGAGAGGGAAAAGAAGGTGG + Intergenic
1079954244 11:26842836-26842858 TTCAAAGTGGGAAAAGAAGGTGG - Intergenic
1080023784 11:27592700-27592722 GATTGAGTGGGAAAAGTGGGAGG + Intergenic
1080112579 11:28585061-28585083 GTATCTGAGGGAAGAGAAGGTGG - Intergenic
1080719886 11:34838492-34838514 GTTTCAAAGGGAAAGGAAGTGGG + Intergenic
1081521529 11:43886450-43886472 TTCTCAGTGGTAGAAGAAGGTGG + Intronic
1081571416 11:44293808-44293830 GCTCCTGTGGGTAAAGAAGGAGG - Intronic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1083290033 11:61684719-61684741 GTTTCTGTGGGAAGTGAGGGCGG + Intronic
1083400318 11:62418865-62418887 GTTTCAGTGGGGACAGAAACTGG + Intronic
1085241412 11:75059425-75059447 TCTTCAGTGGGAGGAGAAGGTGG + Intergenic
1085651058 11:78269108-78269130 GTCTCAGTGGAAAAAAAGGGTGG + Intronic
1085743911 11:79098815-79098837 ATTTCAGTGTGAAAGGAACGTGG + Intronic
1086468037 11:87075531-87075553 GTTTCAGTGGCCAAGGCAGGAGG - Intronic
1087212790 11:95460664-95460686 CTTTTACTGGGCAAAGAAGGTGG + Intergenic
1087774802 11:102247494-102247516 GTTTCAGTGAGACAAGATCGTGG - Intergenic
1087974690 11:104530412-104530434 GCTTCAGTGGAACAAAAAGGTGG + Intergenic
1088209134 11:107433728-107433750 GTTTCAGTGGTAGAAGATGGTGG - Exonic
1088235971 11:107723288-107723310 GTTTCAGAGAAAAAAGAAAGAGG - Intergenic
1089616269 11:119696581-119696603 GCTTGAGTGGGAAATGAGGGAGG + Intronic
1089769212 11:120790756-120790778 GCGGCAGTGGGAACAGAAGGGGG + Intronic
1089923737 11:122235433-122235455 GATTCAGAGGGAAAAGAAACTGG + Intergenic
1090447928 11:126780059-126780081 ACTTCAGAGGGAAAAGCAGGAGG + Intronic
1092125784 12:6074138-6074160 ATTTCATGGGGAAAAGGAGGAGG - Intronic
1094698959 12:32849837-32849859 GTTTCAGTGAGCTAAGGAGGTGG + Intronic
1096529158 12:52232667-52232689 GTTTCTATGGGAAATGAAGTAGG + Intronic
1097052091 12:56229875-56229897 CTTTCTGTGGGAAAAGGAAGAGG + Intergenic
1097389815 12:58996424-58996446 GGATCAGTGGGGAAAGAAAGAGG - Intergenic
1099033164 12:77554288-77554310 GGTTCAGTGGAAAAAGGAGTAGG + Intergenic
1100067974 12:90673865-90673887 GTTTCAACGGCAAGAGAAGGAGG + Intergenic
1100705600 12:97197103-97197125 GTTTCAGTTGCCAAACAAGGAGG - Intergenic
1100958883 12:99940427-99940449 GTTTCAGGGGGAAAAAAACTAGG + Intronic
1101116210 12:101533918-101533940 GACTCAGTGTGAAAAGGAGGAGG - Intergenic
1101129918 12:101678517-101678539 GTTTCACTTGGAAAATTAGGTGG + Intronic
1101310536 12:103574896-103574918 GTTTGAGAGGCAAGAGAAGGAGG - Intergenic
1101361829 12:104034610-104034632 GTTTGAGTGGGTAAACAAAGTGG + Intronic
1102157520 12:110742860-110742882 GTTCCAGTGGGGAGAGAAGGAGG - Exonic
1102594014 12:113978560-113978582 GTTTCACTGCCAAGAGAAGGAGG - Intergenic
1102939555 12:116927500-116927522 TTTTCACTGGGAAAAGAACAGGG - Intronic
1103477643 12:121230378-121230400 GTCTCAGGGGGAAAAAAAAGAGG + Intronic
1103562024 12:121797807-121797829 GTTTCAGGGAGTATAGAAGGAGG + Intronic
1104112978 12:125721560-125721582 GTTTCAAGAGGAAAAAAAGGTGG + Intergenic
1106455119 13:29920113-29920135 GTTTTAGAGGGAACAGAGGGGGG - Intergenic
1106846601 13:33743826-33743848 CTCTCAGTGGGAAGAGAAGGGGG + Intergenic
1107631740 13:42350041-42350063 GTGGCAGTGGAAATAGAAGGAGG - Intergenic
1107780944 13:43901648-43901670 GCTTCAGTCTGAAAAAAAGGAGG - Intergenic
1108120099 13:47176190-47176212 CTTTCAGTAGGAAAAAAAAGAGG + Intergenic
1111847041 13:93524000-93524022 ATTTCAGTGGAAAGAGAGGGGGG + Intronic
1114050817 14:18918943-18918965 GATGGAGGGGGAAAAGAAGGAGG - Intergenic
1114069671 14:19097360-19097382 GGTTCAGTGGGCAAAGAGAGGGG - Intergenic
1114111742 14:19482979-19483001 GATGGAGGGGGAAAAGAAGGAGG + Intergenic
1114461708 14:22890313-22890335 GTGGCAGTGGGAAAGGAAGGAGG + Intergenic
1114477885 14:23010392-23010414 GTTTCACTGAGAAAAAAAGATGG - Intergenic
1114736285 14:25047268-25047290 TTTACAGTATGAAAAGAAGGGGG + Intronic
1115945858 14:38659644-38659666 ATTTCACTGGTAAAACAAGGAGG - Intergenic
1117293156 14:54353195-54353217 GTTTCAGCTGGCAAAGAGGGAGG - Intergenic
1117369088 14:55059599-55059621 ATATCTGTGGGAAATGAAGGAGG + Intronic
1117818315 14:59621001-59621023 GATTCAGTGGGAAGGGTAGGAGG + Intronic
1118446294 14:65854060-65854082 ATTTCAAAGGGAAAAGAAGCTGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119631191 14:76233575-76233597 ATGACAGTGGGAGAAGAAGGTGG - Intronic
1121980289 14:98448529-98448551 GTTTCAGTGGGGAAGTAAGTGGG + Intergenic
1122751948 14:103942211-103942233 GTTTCGGTGGGTAAATAAGGTGG - Exonic
1125346051 15:38720122-38720144 GTCTCAGTGGGGACATAAGGAGG + Intergenic
1126685143 15:51241870-51241892 GTCTCAGTGGGATCAGAAGTGGG - Intronic
1127399006 15:58566565-58566587 GTGCAAGTGGGAAAAGAAGTAGG + Intronic
1128385829 15:67147531-67147553 TGTTCAGGGGGAAAAGAAGGTGG + Intronic
1130956380 15:88630126-88630148 GGTGCAGTGGGAACAGCAGGAGG + Exonic
1131318047 15:91358143-91358165 GTACCAGTGGAAAAAAAAGGAGG - Intergenic
1131969677 15:97879181-97879203 AGTTTAGTAGGAAAAGAAGGGGG - Intergenic
1132917455 16:2359147-2359169 TTTCCAGTGGGGAAAGAAAGGGG - Intergenic
1133906710 16:10029098-10029120 GATTCAGTGGGGACAGAAAGAGG - Intronic
1134419970 16:14077800-14077822 GTAACAGTGGGAAAAAAATGAGG - Intronic
1135869470 16:26136215-26136237 TTTTCAGTGGGAACAGGAAGAGG + Exonic
1136481438 16:30544535-30544557 GTTACAGGGGCAAAAGAAGGAGG + Intronic
1137835320 16:51586827-51586849 ATTTCAGTGGAAAAAGAACAAGG + Intergenic
1137865593 16:51892796-51892818 GTCCCAGTGAGCAAAGAAGGTGG - Intergenic
1138104524 16:54280691-54280713 TTATCAGTGGGGACAGAAGGTGG + Intergenic
1138140774 16:54566787-54566809 ATTTCTGTGGGGAAAGTAGGGGG - Intergenic
1140638050 16:76939948-76939970 ATTTCAGGGAAAAAAGAAGGTGG + Intergenic
1140830868 16:78749571-78749593 ATTTCAGTGGGGAAAAAAAGTGG + Intronic
1141109395 16:81259577-81259599 GTTTTACTGGGAGAAGAAGGTGG - Intronic
1141161635 16:81632979-81633001 GTTTCTTTGGGCAAGGAAGGGGG + Intronic
1141417182 16:83884784-83884806 GTGGCAGTGGGACAAGATGGTGG - Intergenic
1141525116 16:84606198-84606220 GCTTAAGTGGGAGAGGAAGGTGG + Intronic
1141733996 16:85840274-85840296 GTCTCCATGGGAAAGGAAGGAGG - Intergenic
1141846677 16:86614253-86614275 GTTTTAGTGGAAAATGCAGGTGG + Intergenic
1141931106 16:87203475-87203497 GTTTCAGTGGTCAATCAAGGTGG - Intronic
1142905841 17:3041272-3041294 GTCTCTGTGGGAAATGTAGGAGG + Intergenic
1143692949 17:8586167-8586189 GCTTCAGTGGGAAAGTATGGAGG - Intronic
1145035542 17:19537935-19537957 GTTTCTGGGGGAAATGAAGTGGG - Intronic
1146542844 17:33712483-33712505 GTTTCTGTGGGTAAAGAATTCGG + Intronic
1146657424 17:34643040-34643062 TTTTAAGTGGGAGAAGAAGAGGG + Intergenic
1147919534 17:43907407-43907429 GTGTCAGGACGAAAAGAAGGCGG + Intronic
1148013287 17:44503120-44503142 GTTTCAGGGGTAAGAGAATGCGG + Intronic
1148479915 17:47953292-47953314 GGGTCAGTGGGAAAAGGGGGTGG + Intronic
1148902297 17:50887555-50887577 GTTTCAGTGTGACAAGGAAGAGG - Intergenic
1150891042 17:69150096-69150118 GTTTCAGTGTGATAATACGGGGG + Intronic
1151371412 17:73648444-73648466 TTTTGCCTGGGAAAAGAAGGTGG + Intergenic
1151454494 17:74217927-74217949 GTTGCTGTGGGACAAGGAGGTGG + Intronic
1151723189 17:75869890-75869912 GTTTCTGTGGGAAAATGAGCTGG - Intergenic
1151769797 17:76153108-76153130 GTTTCACTGAGAAAAAAAGAGGG - Intronic
1152676569 17:81644456-81644478 GTTTCAGAGGGGAAAGAAAAGGG + Intronic
1152815227 17:82403991-82404013 GTTTATGCGGGAGAAGAAGGTGG + Exonic
1153310947 18:3676425-3676447 GTTTAACAGGCAAAAGAAGGAGG - Intronic
1154465625 18:14641145-14641167 GATGCAGCGGGAAAAGAGGGTGG - Intergenic
1155145179 18:23077562-23077584 GTGTAAGTGAGAAAAGCAGGGGG + Intergenic
1155840880 18:30641062-30641084 GTTTTAGTGTTAAAATAAGGTGG - Intergenic
1156877186 18:42029062-42029084 GTTTATGTGGGAAAAAAATGCGG + Intronic
1157144006 18:45142696-45142718 GTTGCAGAGGGAAGAGCAGGTGG + Intergenic
1157285502 18:46374684-46374706 GTTGAAGGGGGAAAAGATGGGGG - Intronic
1157730803 18:50002535-50002557 TCTTCATTTGGAAAAGAAGGGGG + Intronic
1157884192 18:51350580-51350602 GTTTCAGGGAGAAGGGAAGGGGG - Intergenic
1157907726 18:51584560-51584582 GTTTTGGTGGGCAAAGGAGGTGG + Intergenic
1157959287 18:52134406-52134428 GTTTCAGTACCTAAAGAAGGAGG + Intergenic
1158485017 18:57858500-57858522 GATTCAGGGGGAAAAAAAGAGGG - Intergenic
1159222917 18:65488640-65488662 CTTTCAGTGGCAGGAGAAGGAGG - Intergenic
1159314586 18:66755330-66755352 GTTTCTGAGGAAAAATAAGGAGG + Intergenic
1162771866 19:12954004-12954026 GCTTCAGTGGGAGGAAAAGGGGG - Exonic
1162783757 19:13021497-13021519 GTTTCAGTTGGGGAAGAAAGGGG + Intronic
1163518657 19:17779476-17779498 GTGGCAGTGGGAGAAGCAGGTGG + Intronic
1163748672 19:19062845-19062867 GTTTCATTTGGAAAAGAGGGGGG - Intergenic
1165084057 19:33330365-33330387 AATTCAATGGGAAAAGGAGGGGG + Intergenic
1166185593 19:41136906-41136928 GTTTCTGTGGGCAGAGAAGATGG - Intergenic
1166939073 19:46352047-46352069 GCTCCAGAGGGAAAGGAAGGAGG - Intronic
1167241543 19:48346506-48346528 GTTTAAGTGAGAGATGAAGGTGG - Intronic
1167367426 19:49062055-49062077 ACTTCAGTGGGGAAAGAAGTTGG + Intronic
1167717130 19:51150691-51150713 GTTTCAGTAGGAACAGAAGGAGG + Intronic
925038321 2:709291-709313 GTTTCCGGGGAAGAAGAAGGTGG - Intergenic
925526834 2:4812732-4812754 GTCTCAGAGAGAAAAGAATGAGG + Intergenic
925815705 2:7746278-7746300 GTCTGAGTGGGAATAGACGGGGG - Intergenic
926634209 2:15163342-15163364 GTTTCTGAGGGAAAAGCAAGTGG + Intergenic
927062050 2:19432526-19432548 GTTTCTCTGGGAAAGGAAGATGG - Intergenic
927472448 2:23385984-23386006 GCTCCAGGGGGAAAAAAAGGGGG + Intronic
927671281 2:25070753-25070775 GTGGCAGTGGGAAGAGATGGAGG + Intronic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
928125067 2:28609859-28609881 GTGGCAGTGGGAAAAGGAAGAGG - Intronic
928336605 2:30404027-30404049 GTTTTAGAGGGAAAATGAGGAGG - Intergenic
928562632 2:32506953-32506975 ATTTCAGTGGTAAAAAAAGAAGG - Intronic
928753533 2:34497597-34497619 GTTTCAGTGTGAAATAAAGCAGG + Intergenic
929771293 2:44894375-44894397 GTCTTAATGGGAAAAAAAGGGGG + Intergenic
929887972 2:45895338-45895360 GTTTCAGTCGGGGAAGAAAGTGG + Intronic
929937065 2:46300644-46300666 CTTTCACTGGGAAAAAAATGTGG + Intronic
929979593 2:46666147-46666169 GTTGCAGTGGGAATAAAAGGAGG + Intergenic
930711287 2:54553209-54553231 GTTTTAGGGAGAAAAGAAGGTGG + Intronic
932981708 2:76676553-76676575 ATCTCAGTGGCAGAAGAAGGTGG + Intergenic
934731456 2:96661264-96661286 GTTTCAGGGGAGAAGGAAGGAGG + Intergenic
934953119 2:98592847-98592869 TTTTGAGTGGGAAAAGCTGGTGG + Intronic
935083355 2:99821176-99821198 CTTCCAGTGGGAAAAGATGTAGG - Intronic
936233511 2:110724694-110724716 GTGTCAGTGCAACAAGAAGGAGG + Intergenic
936292877 2:111239877-111239899 GGTACAGTGGGAAAAAAAAGAGG + Intergenic
937092916 2:119218361-119218383 GTCTCAGTGGGGATTGAAGGGGG + Intergenic
937218886 2:120330088-120330110 GTTTCAGTAGGAAAGAAATGAGG + Intergenic
937661506 2:124435046-124435068 GTTTCAGAGGGAAAATGACGGGG + Intronic
939964365 2:148596062-148596084 GTTTCAGTGGGTAAAGACTTTGG + Intergenic
940660276 2:156536890-156536912 GATTCTGTGGGAAGAGGAGGGGG + Intronic
940739038 2:157485851-157485873 CTTGCAGTGGGAAGAGAAGAGGG - Intronic
940780115 2:157924416-157924438 GTGTCAGTGGGATATGCAGGTGG - Intronic
940990513 2:160091891-160091913 ATGGCAGTGGGAAAATAAGGAGG - Intergenic
941538296 2:166749377-166749399 CTTTCTGTGGGAAAAAAAGTTGG + Intergenic
942544489 2:177048920-177048942 GCTTCATTGGGGAAAAAAGGAGG - Intergenic
942932739 2:181515122-181515144 GTTTCAGTGTGATAAGAACTTGG - Intronic
943117982 2:183696840-183696862 GTTCAAGTGTGAGAAGAAGGTGG - Intergenic
943769914 2:191705219-191705241 ATTTGAGTGGGAGAGGAAGGTGG + Intergenic
944353982 2:198763263-198763285 GTGACAGTGGGAACAGAAGAAGG - Intergenic
945677470 2:212872793-212872815 GTAACAGTGGCAAAAAAAGGAGG + Intergenic
945929756 2:215842997-215843019 CTTTTAATGGGAAAAGAAGTGGG - Intergenic
946191361 2:218009722-218009744 ATTTCCGTGGGAAGGGAAGGTGG - Intergenic
946286045 2:218703628-218703650 GATTAAGTGAGTAAAGAAGGTGG + Intergenic
946863900 2:224025465-224025487 TTCTCATTGGGAAAAGAAGAGGG - Intronic
947144706 2:227054251-227054273 GTTTCAGTTAGAACAGAAGTTGG - Intronic
947304789 2:228732531-228732553 GTTACTGTTGGAAAACAAGGAGG - Intergenic
948134724 2:235628082-235628104 CTTCCAGTGGGAGGAGAAGGGGG + Intronic
1169142405 20:3233876-3233898 GTTCCACTGCGACAAGAAGGGGG + Intronic
1169329666 20:4706389-4706411 ATTCGAGTGGGAAGAGAAGGGGG + Intergenic
1169746621 20:8949796-8949818 GTTTCAAAGGGCAAAGAATGAGG - Intronic
1170683978 20:18552384-18552406 GTTCCAGTGGGAAGAGCAGCTGG - Intronic
1171361706 20:24590618-24590640 GTTGCAGTGTGAAAGGAAGAGGG + Intronic
1172221517 20:33277468-33277490 CTTTCAGGGGCAAAGGAAGGAGG - Intronic
1173109820 20:40176213-40176235 GGTTGAATGGGAAAAGAAAGGGG - Intergenic
1173315140 20:41936444-41936466 ATTTCAGTGGGAACACTAGGAGG - Intergenic
1173882500 20:46426763-46426785 GTTTCAGTGGGAACAAAATTAGG + Intronic
1174687860 20:52472749-52472771 GTTACATTGACAAAAGAAGGGGG + Intergenic
1174778367 20:53366059-53366081 GTGTCAGAAGAAAAAGAAGGGGG + Intronic
1175706982 20:61186674-61186696 GTTTGAGTGGAAAAGGCAGGAGG - Intergenic
1176808932 21:13517337-13517359 GATGCAGCGGGAAAAGAGGGTGG + Intergenic
1180469294 22:15641318-15641340 GATGGAGGGGGAAAAGAAGGAGG - Intergenic
1180857322 22:19056750-19056772 TCTTCCGTGGGAAAAGAAGCTGG + Intronic
1180896290 22:19335693-19335715 GATACAGTGGGAAAAATAGGGGG - Intronic
1182810947 22:33116189-33116211 GCTCCTGCGGGAAAAGAAGGTGG - Intergenic
1184190781 22:42892965-42892987 TTTTCGGTGGGGACAGAAGGGGG + Intronic
949233787 3:1784061-1784083 GATTCTGTGGGAAAACAAGACGG + Intergenic
952257076 3:31704934-31704956 TTTACAGTGGGAAAGGATGGAGG - Intronic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
953656181 3:44856565-44856587 GTTTCAGTGGGAAAGTAGGTGGG + Intronic
954087700 3:48258901-48258923 GTTTCAGTGGAAAAACTAGAGGG + Intronic
954090036 3:48276929-48276951 GATTCAGATGGAGAAGAAGGGGG - Intronic
955040958 3:55317356-55317378 GTTTCAGAGGGTAAAGAATGAGG + Intergenic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
955805933 3:62734460-62734482 ACTTCAGAGGGAAAAGGAGGGGG - Intronic
956401997 3:68889600-68889622 GTTTTAGAGTGAAAAGATGGGGG - Intronic
956633538 3:71340138-71340160 ATGTCAGTGGGAAAATAGGGGGG - Intronic
956641154 3:71416785-71416807 GTTGCAGCAGGAAAAAAAGGGGG + Intronic
957290707 3:78274319-78274341 GTAGCAGTGGGAAAAGAAGGCGG - Intergenic
958722361 3:97859911-97859933 GTTCCAGAAGGAAAGGAAGGAGG - Intronic
959438480 3:106347157-106347179 GATTCTGTGGTACAAGAAGGAGG - Intergenic
959590518 3:108074836-108074858 GTTACAGTGGGAAAAGTTTGAGG + Intronic
959674305 3:109017125-109017147 GTTTCAGAGGGAAAGCCAGGTGG - Intronic
960221386 3:115113460-115113482 TTTTCAGTGCCAAAAGCAGGAGG - Intronic
960626140 3:119684091-119684113 GTTTCATTGGGAAAAGAGAAAGG - Intergenic
960725284 3:120663648-120663670 GATTCAGGAAGAAAAGAAGGAGG + Intronic
960820973 3:121730970-121730992 ATTTCTGTAGGAAAAGAAGGGGG + Exonic
961676849 3:128572857-128572879 GTGGCAGAGGGAAAAGGAGGGGG - Exonic
961690427 3:128665606-128665628 CTTTAAGTGGTAAAGGAAGGGGG - Intronic
962366728 3:134791683-134791705 TCTTCAGCAGGAAAAGAAGGAGG - Intronic
962523610 3:136218994-136219016 GTTTCAGTGGGAAAGTAGGTGGG + Intergenic
963669421 3:148232987-148233009 GGTTGAGCGGGCAAAGAAGGTGG + Intergenic
963808134 3:149747092-149747114 GTATCAGTGGGTAAGAAAGGTGG + Intronic
965442831 3:168737385-168737407 GTTTCTGTTGGAAAAGAAAAAGG - Intergenic
966043596 3:175522489-175522511 TTTTCAGTGGAAACAAAAGGTGG + Intronic
966388270 3:179425042-179425064 TTTTCTCTGGGAAAAGAAGTAGG + Intronic
966402544 3:179562691-179562713 GAGGCAGTGGGAGAAGAAGGAGG - Intergenic
966435178 3:179875934-179875956 GCTTCAGTGTTAAAAGGAGGTGG + Intronic
966622856 3:181984522-181984544 GTTTCAGAGGGGAAAGACAGAGG + Intergenic
966650174 3:182291802-182291824 GTTCCAGTGGGAAGAGAAAGTGG - Intergenic
967721418 3:192820103-192820125 GTTTCTGTGGGGAGAGAAAGGGG + Intronic
968893968 4:3388121-3388143 CTGACACTGGGAAAAGAAGGAGG - Intronic
970403687 4:15742077-15742099 GTTTGAGATGGAGAAGAAGGTGG + Intergenic
970885727 4:20985737-20985759 GGTACAGTGGGAAAACAAGGAGG + Intronic
971064150 4:23008552-23008574 GTTTAATTTGGAAAAGAAAGGGG + Intergenic
971363615 4:25958880-25958902 GTTTCTGTGGGAAAGGCAGGAGG + Intergenic
971752123 4:30663539-30663561 CTTACAGTGGGAAAAGAAGAGGG + Intergenic
971825694 4:31619561-31619583 GGTTCAAAGGGAAAAGAAAGTGG - Intergenic
972066544 4:34953155-34953177 CTTTCAGTGGGAAAGGGAGCTGG - Intergenic
974174977 4:58309990-58310012 CTCTCAGTGGGAAAAGGAGATGG + Intergenic
975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG + Intergenic
978349467 4:107806463-107806485 ATTTCAGTGCCAAAAGAATGAGG + Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
981884193 4:149653127-149653149 TTTTGAGAGGGAAAAGAAGTTGG + Intergenic
981943186 4:150308636-150308658 CTTCCAGTGGGACAAGAATGTGG + Intronic
983758788 4:171378241-171378263 GTTTACGTGTGAAAAGGAGGGGG + Intergenic
984490491 4:180429201-180429223 ATTTCAGCTGGAAAAGATGGGGG + Intergenic
984988128 4:185351297-185351319 GTTTCAGGGGGAAAGGGAAGTGG + Intronic
986429807 5:7670215-7670237 CTTTCAGTGGTGAAAGATGGTGG + Intronic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
987693884 5:21302994-21303016 GTTTCATTAGGAAAAGAAATTGG + Intergenic
988668242 5:33353830-33353852 GTTTGAGTGGGTAAACAAAGTGG - Intergenic
989261346 5:39423161-39423183 CTGGGAGTGGGAAAAGAAGGGGG + Intronic
990161502 5:52944749-52944771 TTTTCAGTGGCAAATGAGGGAGG + Intronic
990343217 5:54845678-54845700 GCCTAAGTGGGAGAAGAAGGTGG - Intergenic
990369367 5:55101900-55101922 GTTTAGGTGAGAAAAGAAGTGGG - Intergenic
991746372 5:69746537-69746559 GTTTCATTAGGAAAAGAAATTGG - Intergenic
991751333 5:69808704-69808726 GTTTCATTAGGAAAAGAAATTGG + Intergenic
991797974 5:70326490-70326512 GTTTCATTAGGAAAAGAAATTGG - Intergenic
991825750 5:70621851-70621873 GTTTCATTAGGAAAAGAAATTGG - Intergenic
991830621 5:70683598-70683620 GTTTCATTAGGAAAAGAAATTGG + Intergenic
991890315 5:71325808-71325830 GTTTCATTAGGAAAAGAAATTGG - Intergenic
995519596 5:112989171-112989193 TGTTCAGTGGGAACAGAAGAGGG + Intronic
995700035 5:114925119-114925141 CTTTCAGTGGAAAAAAAATGGGG - Intergenic
996516358 5:124373659-124373681 TTTTCAGAGGGCAAAGAAGCAGG - Intergenic
996917977 5:128733782-128733804 GTTTCAGTGGGAAAGTAGGTGGG - Intronic
997157679 5:131576692-131576714 GTTTCAGTGGGAGAATAGGTGGG - Intronic
997446075 5:133941357-133941379 TGTGCAGTGGGAAAAGGAGGAGG + Intergenic
997808841 5:136947096-136947118 GTTTCAGTAGGTAAACAAAGCGG - Intergenic
998208498 5:140175962-140175984 GTTGCAGGGGGGAGAGAAGGAGG + Intronic
999510371 5:152244071-152244093 GTCTCTGTGAGAAAAAAAGGCGG + Intergenic
999532806 5:152480735-152480757 GTTGCAGTGAGCAAAGATGGCGG + Intergenic
999682411 5:154072561-154072583 TTTTGAGTGGGAACAGCAGGGGG + Intronic
999866080 5:155701913-155701935 AATTAAGTGGGAAAAGAATGGGG + Intergenic
1001722412 5:173867467-173867489 TGTGCAATGGGAAAAGAAGGAGG + Intergenic
1003550806 6:7100722-7100744 AATTCAGTGGAAAAAGAAGAGGG - Intergenic
1003626104 6:7742912-7742934 ATTTAAGTGGGATAAGAAGGGGG - Intronic
1003715123 6:8637889-8637911 TTTTCTCTGGGAAAAGAAGTGGG + Intergenic
1005557026 6:26996925-26996947 GTTTCATTAGGAAAAGAAATTGG - Intergenic
1006016738 6:31087279-31087301 GTTTTAGCAGGAAAAGGAGGGGG - Intergenic
1006414547 6:33895701-33895723 CTTTCAGTGGGCAAAGCAAGGGG - Intergenic
1006680374 6:35792950-35792972 GTTTCAGTTGGCAGGGAAGGGGG - Intronic
1007493787 6:42245019-42245041 GTGTCAGGGGGATGAGAAGGGGG - Intronic
1008065032 6:47038375-47038397 GTTTCATTGGGAAAAATAGTTGG - Intronic
1008180374 6:48320731-48320753 GTTTCATGGGGAAAGGATGGAGG + Intergenic
1008900071 6:56603256-56603278 GTTGCTGAGGGAAGAGAAGGCGG + Intronic
1009749232 6:67861744-67861766 GCTTCACTGGGAAAAGTTGGTGG + Intergenic
1010005341 6:70989948-70989970 TTTTCAATGGGTAAAGAAAGAGG - Intergenic
1010021821 6:71169220-71169242 GTTTCTTTTGGAAAAAAAGGAGG + Intergenic
1010749374 6:79600804-79600826 GATTTAGTGGCAAAAGAAGCTGG - Intergenic
1011215186 6:84998102-84998124 GTTTGATTGCCAAAAGAAGGTGG - Intergenic
1011887152 6:92110085-92110107 GATTCAGTGTGAAAAAAATGAGG - Intergenic
1012355962 6:98314981-98315003 TTTTCAGTTGGAAAAGAATGTGG - Intergenic
1012927944 6:105286506-105286528 GTCACAGTGGAAAGAGAAGGGGG - Intronic
1013094235 6:106929821-106929843 GTCTGAGTGGGAAAGGCAGGAGG + Intergenic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1013316542 6:108948604-108948626 GCTTCAGATGGAAAAGGAGGGGG - Intronic
1013321215 6:108991662-108991684 GTTTCAGGTGGAAAGAAAGGAGG - Intronic
1013627382 6:111951395-111951417 GGGTCAGTGGAAAAAGAAAGAGG + Intergenic
1013774885 6:113668668-113668690 ATCTCAGTAGAAAAAGAAGGAGG - Intergenic
1013883687 6:114935191-114935213 GTGTCAGTGGGAATCCAAGGAGG + Intergenic
1015839257 6:137459496-137459518 GTTCCAGTGGGAGAAGAATCAGG + Intergenic
1016010237 6:139131953-139131975 GTTTCAGTTTGAATAGAAGGAGG + Intergenic
1018355612 6:163011908-163011930 CTTCCAGTGGGACAAGAAGTGGG - Intronic
1018708834 6:166483235-166483257 TTTTCTCTGGGAAATGAAGGTGG - Intronic
1019853671 7:3583816-3583838 ATTTCACTGGAGAAAGAAGGTGG + Intronic
1019860347 7:3652959-3652981 ATTGCAGTGGGCAAAGAAGTGGG + Intronic
1020047970 7:5057661-5057683 CTGTTAATGGGAAAAGAAGGAGG - Intronic
1020531228 7:9338478-9338500 GAATGAGAGGGAAAAGAAGGAGG + Intergenic
1020647679 7:10834924-10834946 ATTTCTGTGTGAAAAGAAGATGG - Intergenic
1020846136 7:13286015-13286037 GTTTCAGTGAGCCAAGATGGCGG + Intergenic
1021170259 7:17390959-17390981 CTTGCAGTGGGGAAAGGAGGAGG - Intergenic
1021902153 7:25296766-25296788 GTTCAGGTGGGACAAGAAGGAGG - Intergenic
1022314970 7:29237257-29237279 GGCTCAGTGGGAAAAGTTGGTGG + Intronic
1022959960 7:35417009-35417031 GATTCAGTTAGAAGAGAAGGAGG + Intergenic
1024299894 7:47879000-47879022 ATTTCAGAGGCAAAAGAAAGAGG + Intronic
1024687726 7:51765842-51765864 GTGTCAGGGGGAACTGAAGGAGG - Intergenic
1025760748 7:64388810-64388832 GTTCAGGTGGGAAAAGAAGAAGG - Intergenic
1027143695 7:75679106-75679128 GTTTAATTGGGAAAGGAAGAAGG - Intronic
1027769659 7:82390950-82390972 TTTTCATGGGGAAAAAAAGGAGG - Intronic
1028477710 7:91268266-91268288 ATTTCAGGAGGTAAAGAAGGTGG + Exonic
1028689361 7:93634281-93634303 GTGTCAGTGGGAGAAGAAATAGG + Intronic
1029242111 7:99170460-99170482 GTTTCAGTGGGAAAAAAAAATGG + Intergenic
1029907104 7:104103197-104103219 GTTCCACTGGGAAAGGTAGGAGG + Intergenic
1030969334 7:116034941-116034963 GTTTCAGTGGGGGAAGATGGGGG - Intronic
1034287536 7:149897988-149898010 GTTGCAATGAGAAAAGGAGGTGG - Intergenic
1034663591 7:152794919-152794941 GTTGCAATGAGAAAAGGAGGTGG + Intronic
1037692433 8:21193538-21193560 GATTTAATTGGAAAAGAAGGAGG + Intergenic
1038262930 8:26013324-26013346 GTGTCAGTGGGAGAAGCAGGAGG - Intronic
1038867601 8:31456589-31456611 GTTTCTGTGGAAAAAGAATAAGG + Intergenic
1038910786 8:31961681-31961703 ATCTCAGTTGGAAAAGAAGTTGG - Intronic
1038956725 8:32475748-32475770 GTGGCAGAGGGAAAAGAAGATGG + Intronic
1039423699 8:37467669-37467691 GTTTGAGGGGGAAAATAATGAGG + Intergenic
1040648351 8:49424193-49424215 GTTTCAGTGGGAAAGTAGGTGGG - Intergenic
1041196606 8:55407605-55407627 GTGTCAGGGGGAAAAGAGTGCGG - Intronic
1041917177 8:63149385-63149407 GTTTCAGTGGGGGCAGTAGGTGG + Intergenic
1042748457 8:72133199-72133221 GCTACAGGGGCAAAAGAAGGAGG + Intergenic
1042785507 8:72541956-72541978 GTTTCACAGGGAAAAAAATGGGG - Intronic
1043005720 8:74815642-74815664 GTATGGATGGGAAAAGAAGGTGG + Intronic
1045102677 8:98861230-98861252 GTTTCTGGTGGAAAAGAAGATGG - Intronic
1045390140 8:101707123-101707145 GATTCTGGGGGAAAAAAAGGAGG - Intronic
1045533130 8:103003078-103003100 GTTTCAGTGGGGAAGTAAGTGGG - Intergenic
1046952816 8:120034195-120034217 GTTTTGGTGGGAAAAGTAAGAGG - Intronic
1047924805 8:129672170-129672192 GTTTCATTGGGCAGAGGAGGTGG + Intergenic
1048067886 8:130989867-130989889 GATACAGTAGGAAAAGAAGTTGG - Intronic
1048156193 8:131955778-131955800 GTTGCAGAAGGAGAAGAAGGAGG - Exonic
1049741563 8:144243408-144243430 GTTTCAGAGGAAAGAAAAGGGGG + Intronic
1049949168 9:627695-627717 GTTTCAGGGGGACCAGAGGGTGG + Intronic
1051993615 9:23184945-23184967 GTTTCAGTGGGTCAGGAAGTCGG - Intergenic
1053751708 9:41263678-41263700 GTTTCAGTAGGTAAACAAAGTGG - Intergenic
1053911804 9:42914327-42914349 GTTTCAATGAAAAAAAAAGGGGG - Intergenic
1054257235 9:62828007-62828029 GTTTCAGTAGGTAAACAAAGTGG - Intergenic
1055707631 9:79023854-79023876 GATCCATTGGGGAAAGAAGGTGG - Intergenic
1055813770 9:80181500-80181522 GTTTCAGTCGCCAAACAAGGAGG - Intergenic
1056381383 9:86060251-86060273 GTTCCAGAGGAATAAGAAGGTGG + Intronic
1057281960 9:93719827-93719849 GATCCAGTGGGAAGGGAAGGGGG - Intergenic
1057379551 9:94555536-94555558 GATGAAGGGGGAAAAGAAGGTGG + Intergenic
1057863415 9:98660765-98660787 GTTTGAGTGAGGAAAGAAAGGGG - Intronic
1058229926 9:102413026-102413048 GTGGCAGTGAGAAAAGATGGTGG + Intergenic
1058423362 9:104854557-104854579 GTTTCTGTGAGACAGGAAGGTGG + Intronic
1058669521 9:107348855-107348877 GTTTATGTGGGAACAGCAGGTGG - Intergenic
1058672958 9:107376175-107376197 GTTTCAGTGGGAAGGTCAGGAGG + Intergenic
1058808551 9:108617012-108617034 GTTTAAGTGAGAGAAGAAGGTGG - Intergenic
1058866111 9:109163869-109163891 GATTCAGTGGAGAAGGAAGGAGG - Intronic
1058951854 9:109911180-109911202 TTTTTAGGGGGAAAAGGAGGGGG + Intronic
1059544148 9:115159487-115159509 GTCTCTGTGGGAAAAGATGGAGG + Intronic
1059575796 9:115486949-115486971 GATTCAGAGGCAAAAGAAGTGGG - Intergenic
1059718972 9:116940429-116940451 CTTCCAGTGGGACAAGATGGAGG + Intronic
1061094290 9:128445690-128445712 GTTGCAGTGGGAAAAGGATTGGG + Intergenic
1061520179 9:131113139-131113161 GCTTCAGTGAGAAATGAGGGAGG + Intronic
1061701277 9:132417887-132417909 TTTTCAGTGAGAGCAGAAGGGGG - Intronic
1061803376 9:133125035-133125057 ATTTCAGAGGAAAAAGAAAGGGG + Intronic
1061898904 9:133662950-133662972 TTATCAGGGGGAAGAGAAGGTGG + Intergenic
1185868035 X:3640015-3640037 CTTTCAGTTGGAAACAAAGGAGG - Intronic
1186225326 X:7393070-7393092 GTTTCTCTGGGAAAAGAGGAAGG - Intergenic
1186961489 X:14741526-14741548 GAGTCAGTAGGCAAAGAAGGGGG - Intergenic
1187614251 X:20975961-20975983 GCTTCAGTGGGGGAAGAAAGGGG - Intergenic
1187772251 X:22713074-22713096 GTTCCAGTGGGGAGAGAAGGAGG + Intergenic
1188200578 X:27290022-27290044 GTTTCAGTGGGAGAACAGGCGGG + Intergenic
1189578172 X:42377299-42377321 ATTTCATTGGGAAATGAAGTAGG + Intergenic
1192159012 X:68768987-68769009 GTTTCAGTTGCTAAAAAAGGGGG + Intergenic
1192764149 X:74125370-74125392 GTTTCAGTGGGAGAATAGGTGGG + Intergenic
1194335710 X:92643944-92643966 GGCTCAGTGGGAAAAGACTGTGG - Intergenic
1194821622 X:98514377-98514399 TTTTCAATGGAAAAAAAAGGAGG - Intergenic
1195679516 X:107533776-107533798 GCTTAAGTGGGTAAAGAAGAAGG - Intronic
1196464604 X:115959225-115959247 TTTTCAGTGGCAAATGATGGAGG - Intergenic
1197498289 X:127213095-127213117 ATATCAGTGGGAAAATAAGAAGG - Intergenic
1199199758 X:145073709-145073731 TTTTCTGTTGGAAAGGAAGGGGG - Intergenic
1199219893 X:145305912-145305934 CTTTCAGTGGGAAGGGGAGGTGG + Intergenic
1199853565 X:151741841-151741863 GTCTCAGTGGGAAGGGGAGGGGG + Intronic
1200085758 X:153603919-153603941 GTATCAGGGAGAGAAGAAGGAGG + Intergenic
1200644139 Y:5760695-5760717 GGCTCAGTGGGAAAAGACTGTGG - Intergenic
1200796197 Y:7343333-7343355 CTTTCAGTTGGAAACAAAGGAGG + Intergenic
1200813241 Y:7505708-7505730 GTTTCAGTGGGAGAGTAAGTGGG - Intergenic
1200898241 Y:8399707-8399729 TGTGCACTGGGAAAAGAAGGTGG + Intergenic
1201455514 Y:14163765-14163787 GTTTCAGTTGGGAAATAATGGGG - Intergenic