ID: 952468767

View in Genome Browser
Species Human (GRCh38)
Location 3:33621168-33621190
Sequence ATTTTGTCCTGGAGGCACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952468767 Original CRISPR ATTTTGTCCTGGAGGCACTA TGG (reversed) Intronic
902259537 1:15214402-15214424 ATTTTCTCCTGCAGGAAGTAGGG + Intronic
903376814 1:22871640-22871662 ATTTTGTTCTGGCAGCAATAGGG - Intronic
904466361 1:30710341-30710363 ATTTTATTCAGGAGGCAGTAGGG + Intergenic
905303654 1:37003034-37003056 TTTTTGTCCCAGAGGTACTAGGG + Intronic
905520625 1:38596816-38596838 ATTTTGTCCTGGACACACATTGG - Intergenic
906268524 1:44455258-44455280 ATTTTGTGCTTGAGGCATTTTGG - Intronic
906270305 1:44472605-44472627 ATTTTATCCTGTAGGCAATTGGG - Intronic
906367232 1:45221055-45221077 ATTTTATCCTGTAAGCACTTAGG + Intronic
906469165 1:46113185-46113207 ATTTTATCCTGCAGGCATTTGGG - Intronic
907769623 1:57447674-57447696 ATTTTCTTTTGTAGGCACTAGGG - Intronic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
909459634 1:75894999-75895021 ATTTTGCCCTTGAGTTACTAGGG - Intronic
909889760 1:80989994-80990016 ATTTTGTTCTGGAAACAATAGGG - Intergenic
910053086 1:82999249-82999271 ATTTCTTTCTGGAGGCTCTAAGG + Intergenic
913192135 1:116421812-116421834 ACTTTTTTCTGGAGGCTCTAGGG - Intergenic
913201377 1:116497460-116497482 ATTTTGTCTTGGGGTCACTGGGG + Intergenic
913401560 1:118440043-118440065 ATTTTATCCTGTGGGCAATAGGG + Intergenic
915010117 1:152677486-152677508 TTTTTGTCTTAGTGGCACTAAGG - Intergenic
916665524 1:166963645-166963667 ATTTTGTCCTGGAGGGAATGGGG - Intronic
917169542 1:172155703-172155725 ACTCTGTCCTGGAGATACTAAGG + Intronic
917316654 1:173732896-173732918 ATCTTGACCTGGAGGCTCTTTGG + Intronic
919846558 1:201646515-201646537 ATTCTGTCCTTGAGGAACTCTGG - Intronic
920089950 1:203445353-203445375 AGTTTCTTCTGGAGGCTCTAGGG - Intergenic
922631979 1:227124745-227124767 ACTTTATCCTGGAGGCAATGAGG + Intronic
1063203215 10:3806008-3806030 ATCTTGTCCTGAAGGCAGCAGGG - Intergenic
1065313521 10:24439617-24439639 ATTCTTTTCTGGAGGCCCTAGGG + Intronic
1066475341 10:35741476-35741498 TTTTCTTCCTGAAGGCACTAAGG + Intergenic
1068599959 10:58946429-58946451 ATTTTGTTCTGGAGGCTCGGCGG + Intergenic
1070268324 10:74926492-74926514 ATTTTCTCCTGTAGGCAATATGG - Intronic
1070534732 10:77367335-77367357 ATTTTATCTTGGAAGAACTATGG + Intronic
1071927588 10:90428497-90428519 ATTTCCTTCTGGAGGCTCTAGGG + Intergenic
1072424850 10:95321278-95321300 ATTTTATTCTGCAGGTACTAGGG - Intronic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1073648812 10:105336842-105336864 ACTTTGTCCTAGAGACCCTATGG - Intergenic
1074909647 10:117896263-117896285 ATTTTATTCTATAGGCACTAAGG - Intergenic
1077735441 11:4785911-4785933 ATTTTATTGGGGAGGCACTAGGG + Intronic
1078091520 11:8267469-8267491 ACTTCGTCCTTCAGGCACTAAGG + Intronic
1079469637 11:20765989-20766011 ATTTTGTCTTAGAGGCAATTGGG + Intronic
1080144475 11:28964275-28964297 AATTTGTCATTGAGGCAATAAGG - Intergenic
1081701789 11:45157036-45157058 ACTTTGCCCTGGAGGCACGGGGG + Intronic
1081734589 11:45394119-45394141 ACTTTGTCCCACAGGCACTAGGG + Intergenic
1085022925 11:73220273-73220295 ATTTTATCCTGAAGGCAATAGGG + Intronic
1085704398 11:78773144-78773166 AATTAGTCCTGGAGGAAGTAGGG + Intronic
1085730601 11:78995316-78995338 ATTTTGTCCTGAGGGCAATGGGG + Intronic
1088051421 11:105519718-105519740 GTTATCTCCTGGAGTCACTAGGG - Intergenic
1088218338 11:107539206-107539228 ATTTTGCCCTGGAGACACCTTGG + Intronic
1089038542 11:115423084-115423106 ATTTTATCCAGTTGGCACTAAGG - Intronic
1089280133 11:117368441-117368463 ATTTTATCCTGAAGGCAGTAGGG + Intronic
1090391629 11:126392668-126392690 ATTTAGTGCTGGAGATACTATGG + Intronic
1091678386 12:2508260-2508282 ATTATGTCCTTCAGTCACTAAGG + Intronic
1091750756 12:3020078-3020100 ATCGTGTCCTGAAGGCACCAGGG - Intronic
1092845343 12:12579805-12579827 ATTCTTTTCTGGAGGCTCTAGGG + Intergenic
1092940210 12:13401106-13401128 ATTTCTTCCTGGAGGCTCTAGGG - Intergenic
1093105538 12:15081710-15081732 ATTCTGTCCTTGAGGAACTTAGG - Intergenic
1094638640 12:32251464-32251486 GTTTCTTCCTGGAGGCTCTAGGG + Intronic
1094697410 12:32834210-32834232 TTTTTGCCCTGGAGGAACTCTGG - Intronic
1095307461 12:40654876-40654898 ATTTTGACCTGTAGTCAATATGG + Intergenic
1095672772 12:44879203-44879225 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
1096256412 12:50064673-50064695 AGTGTGTCCTGGAGGCAGAAGGG + Intronic
1097079512 12:56419659-56419681 ATTCTGTCCTGCAAGCAGTAAGG + Intronic
1098364767 12:69690771-69690793 ATTTGTTCCTGGAGACATTAAGG + Intronic
1098613253 12:72487542-72487564 ATTTTGTCCTTCAGAAACTAAGG + Intronic
1099346892 12:81512231-81512253 ATTTTGTAATGAAGGCATTAGGG - Intronic
1102542282 12:113630094-113630116 ATTCCTTCCTGGAGGCTCTAGGG + Intergenic
1102661344 12:114531513-114531535 ATATTTTCCTGGAGGCACTCAGG - Intergenic
1103699075 12:122838911-122838933 GTTTCCTCCTGGAGGCTCTAGGG - Intronic
1104204812 12:126628581-126628603 ATTTCTGCCTGGAGGCTCTATGG + Intergenic
1104633687 12:130424949-130424971 AATTAGTCCTGGAGGCACCGAGG + Intronic
1109394353 13:61736188-61736210 ATATTGTTTTGGAGGCTCTAGGG + Intergenic
1110126313 13:71947387-71947409 GTTTTCTCCTGGTGGCACTGGGG - Intergenic
1110541389 13:76710161-76710183 ATTTTATCCTGCAGGCCTTAAGG + Intergenic
1110614580 13:77527188-77527210 ATTTCCTTCTGGAGGCTCTAAGG - Intergenic
1112621325 13:101056842-101056864 ATTTTATCCTGTAGGCAATTAGG - Intronic
1112841561 13:103585395-103585417 ATTCTTTCCTGGTGGCTCTAGGG - Intergenic
1116046367 14:39748330-39748352 ATTTTGTCCTGAAATCACTAAGG + Intergenic
1117148193 14:52856379-52856401 CTTTTATCCTGTAGGCAATAAGG + Intergenic
1121699824 14:95944199-95944221 ATTTTATCCTGGAGAAACTGAGG + Intergenic
1123917803 15:25050091-25050113 GTGTTGACCTGGAGGCACTGGGG + Intergenic
1124061999 15:26302150-26302172 ACTTTGTCCTGATGACACTAAGG + Intergenic
1125259022 15:37801115-37801137 ATTTTCTCCTAGAGGCAGTGGGG - Intergenic
1125515889 15:40320922-40320944 ATTTTGTGGAGGAGGCTCTAGGG + Intergenic
1125768338 15:42149666-42149688 ATTTAGTCCTAGAGGCTCTGGGG + Intronic
1126282657 15:46974285-46974307 ACTTTGTGCTAGAGGCCCTAGGG + Intergenic
1126433808 15:48614947-48614969 ACTTTGTCATGGAGGGACAAAGG - Intronic
1126664385 15:51063064-51063086 TTTTTTTCCTGGAGGCTCCAGGG - Intronic
1127021839 15:54756747-54756769 ATTCAGTGCTGGAGGCACTCTGG - Intergenic
1127642380 15:60928162-60928184 ATTTTGTCCTGGAGTCTATGAGG - Intronic
1129107573 15:73320124-73320146 GTCTTGTCCTGGAGGCAGCAGGG - Exonic
1129189969 15:73931434-73931456 ATTTTGTCCTAAAGGCCCTGAGG - Intronic
1130117516 15:81018154-81018176 CTTTTGTGCTGAAGTCACTATGG - Intronic
1130373953 15:83311446-83311468 AATTTGCCCTGTAGGGACTATGG - Intergenic
1130893853 15:88155389-88155411 ATTTCTTTCTGGAGGCTCTAAGG - Intronic
1131756062 15:95563922-95563944 ATTTTATCCTGAGGGCACTAGGG + Intergenic
1135837143 16:25836714-25836736 ATCTAGTCCCAGAGGCACTATGG + Intronic
1137384263 16:48027043-48027065 GTGTTGTCCTGGAGGCAATGTGG + Intergenic
1139584665 16:67893980-67894002 CCTTTGTCCTGAAGGCACTAAGG - Intronic
1146015742 17:29232119-29232141 TTTTTTTTCTGGAGGCTCTAGGG - Intergenic
1146907166 17:36625233-36625255 ACTTTATCGTGGAGGCAATAGGG - Intergenic
1146959896 17:36965241-36965263 CTTTGTTCCTGGAGGCTCTAGGG + Intronic
1147594482 17:41707923-41707945 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
1149790266 17:59470607-59470629 AGTTTGTCTTTGGGGCACTAGGG + Intergenic
1149974840 17:61255060-61255082 AATTTGTTCTGAAGGCACTAAGG + Intronic
1150016043 17:61558540-61558562 TTCTTGTCCTAGAGGCACTAGGG + Intergenic
1151211881 17:72550510-72550532 ATTTTGTCCAGCAGGCCCTGAGG + Intergenic
1151518029 17:74609458-74609480 ATTGTGTTCTGGAGGCCATAGGG - Intergenic
1153349265 18:4060090-4060112 ATTCTGTCCTGGAGACCCTTTGG - Intronic
1155205201 18:23552447-23552469 TTTTTATTCTGGAGGCACTGGGG + Intronic
1155811453 18:30240998-30241020 ATTTTTATCTGTAGGCACTATGG + Intergenic
1157465304 18:47938884-47938906 ATGTTGTCTTTGAGGCACCAGGG + Intergenic
1157521751 18:48350241-48350263 ATTCCTTCCTGGAGGCTCTAGGG + Intronic
1157769932 18:50337116-50337138 ATTTTGTCCTGGGGGCCCTTTGG + Intergenic
1159006366 18:63016423-63016445 AGTTTGTCATGAAGCCACTAGGG + Intergenic
1159553068 18:69917197-69917219 ATTTTATCCTGGAGGCTTTGGGG - Intronic
1161225688 19:3144293-3144315 AGTTTCTCATGGAGACACTATGG - Intronic
1162847790 19:13406823-13406845 ACTTTATCCTGAAGGCACAAGGG - Intronic
1163942471 19:20507952-20507974 GTTTGGTCCTGGAGCCATTAGGG + Intergenic
1164544000 19:29144120-29144142 CTTTTGTCCTGGAGCCATAATGG + Intergenic
1164603313 19:29578100-29578122 ATTATGTCATGAAGGCTCTATGG + Intergenic
1165320540 19:35082380-35082402 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
1166140281 19:40801626-40801648 AGTTTGTCCTGGAGCCACAGTGG + Intronic
1167007087 19:46783096-46783118 ACTTTCTCCTGAAGGCACTGAGG + Intronic
1167077699 19:47259296-47259318 ACTTTGTCCTGAGGGCACTGGGG + Intronic
1167101161 19:47404985-47405007 ACTTTGTCCAGATGGCACTAGGG + Intronic
1167236587 19:48319359-48319381 ACTTTGTCCTGCAGGTACTGGGG - Intronic
1167254342 19:48418416-48418438 ACTTTGTCCTGGGGGTGCTAGGG + Intronic
1167510479 19:49893161-49893183 ACTTTGTCCTGGAGGCAGCGGGG + Intronic
1167631990 19:50631054-50631076 ACTTTGTCCTGAGGGCACTGAGG - Intronic
925372600 2:3357879-3357901 GTTACTTCCTGGAGGCACTAGGG - Intronic
926904762 2:17795381-17795403 ATTATGTGCTGGAGGCACACAGG - Intronic
927199739 2:20570944-20570966 ATTTTATCCTAAAGGCACTAGGG + Intronic
928392384 2:30919549-30919571 CTTTTGCCCTGGAGACTCTAGGG - Intronic
930024384 2:47021386-47021408 TTTTTGTCCTGGAAGCAGGAGGG - Intronic
931180304 2:59892804-59892826 AGTGTGTCCTAGAAGCACTAAGG + Intergenic
931426916 2:62179724-62179746 CTTTTGTCCAGCAGGCACCATGG + Intergenic
933211965 2:79580488-79580510 ATTTTTTTCTGGAGGCTCTAGGG - Intronic
935082379 2:99810787-99810809 GTTCTGTTCTGGAGGCTCTAGGG + Intronic
937026821 2:118705773-118705795 CTTTTGCCCTGGTGGCACTGGGG - Intergenic
937506524 2:122543559-122543581 ATTTTATCATGAAGGCAATAGGG + Intergenic
937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG + Intergenic
938173409 2:129102947-129102969 ATTCCTTCCTGGAGGCCCTAGGG + Intergenic
938230151 2:129651356-129651378 ATTTTCTCCTGGTGGCTCCAGGG - Intergenic
939564511 2:143771132-143771154 ATTTTATCCTGTAGGCAAAAGGG + Intergenic
939877436 2:147593947-147593969 ATTTCTTCCTGGAGGCTGTAGGG + Intergenic
940155952 2:150657489-150657511 ATTTACTCCTGTAGGCACTAGGG - Intergenic
943069406 2:183123153-183123175 ATTTTCTTCTGGAGGCTCCAGGG - Intronic
943458980 2:188146085-188146107 ATTCTTTCCTGAAGGCCCTAGGG + Intergenic
944747660 2:202674743-202674765 TTTTTATCCTGAAGGCAGTAAGG - Intronic
944923642 2:204440519-204440541 ATATAGTCCTGGAGGCTCTAGGG - Intergenic
944991108 2:205237016-205237038 ATTTTATCTTTGAAGCACTATGG - Intronic
945180203 2:207083933-207083955 TTTTTGTTCTGGAGGCTCTAGGG - Intronic
946086584 2:217179516-217179538 ATTATTTTCTGGAGGCTCTATGG - Intergenic
946605369 2:221398806-221398828 ATTTTTTCCTCAAGGCACTCTGG + Intergenic
947304973 2:228735616-228735638 ATTTCCTACTGGAGGCTCTAGGG - Intergenic
1168821347 20:775590-775612 CTTTTGGTCTGGAGGCACCAGGG + Intergenic
1169713500 20:8590610-8590632 ATTTCTTCCTGGAGGCCCTGGGG + Intronic
1170780059 20:19417200-19417222 ATTTTATCCTGAAGACAGTAAGG + Intronic
1171148630 20:22807495-22807517 ATTTTCTCCTGGAGCCTCCAGGG - Intergenic
1172886643 20:38235637-38235659 ATTCTTTCCTGGAGGCTCTAAGG - Intronic
1172971906 20:38879858-38879880 ATCTTGTCCTGGTGGTGCTAAGG + Intronic
1173409575 20:42797911-42797933 ATTCTTTTCTGGAGGCTCTAGGG - Intronic
1175393485 20:58642652-58642674 ACCTTGTCCTTGGGGCACTACGG + Intergenic
1175651255 20:60725854-60725876 ACATTGTCCTGCAGGCACTGGGG - Intergenic
1178158039 21:29877993-29878015 ATTATGCCTAGGAGGCACTATGG + Intronic
1178308530 21:31510311-31510333 ATTTGGTCATAGAGGCACCAGGG - Intronic
1178575974 21:33791832-33791854 ATTTTTTCCTGGATGAAATAAGG + Intronic
1178769320 21:35488186-35488208 TTTTTGCCCTCGAGGCACTTGGG - Intronic
1181911620 22:26242854-26242876 ACTTTGTCATGGTGGCCCTAGGG - Intronic
1182416857 22:30226861-30226883 ACTTGGTCCTGAAGGTACTAGGG + Intergenic
1182960328 22:34466228-34466250 ATTTCTTTCTGGAGGCCCTAGGG + Intergenic
1183737169 22:39650551-39650573 ATTTTGTCCTGAGGGCAATGAGG - Intronic
951994075 3:28707483-28707505 ATTCTTTTCTGGAGGCCCTAGGG + Intergenic
952468767 3:33621168-33621190 ATTTTGTCCTGGAGGCACTATGG - Intronic
955798402 3:62661586-62661608 ATTTTGTCCTGGGAGCAATGAGG + Intronic
956876409 3:73468294-73468316 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
957502955 3:81080636-81080658 ATTCTGTTCTGGAGGTATTATGG + Intergenic
957515211 3:81241191-81241213 AATTCGTACTGGAAGCACTATGG - Intergenic
958553107 3:95641941-95641963 ATTCGTTTCTGGAGGCACTAGGG + Intergenic
959752143 3:109850323-109850345 ATTTTAATCTTGAGGCACTAGGG - Intergenic
960947883 3:122979298-122979320 ATTTCTTCCTGGAGACACCAAGG - Intronic
960956017 3:123031520-123031542 ATTTTATCCAGGAGGAGCTAAGG - Intergenic
961504335 3:127360329-127360351 AGTTTGTCATGGTGGCACCAAGG + Intergenic
961627135 3:128271854-128271876 ATTTTATCCTGGAGACAATGAGG - Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
970687995 4:18590158-18590180 ATATTGGCCTGGAGGGACTGAGG - Intergenic
972102458 4:35439176-35439198 ATTTTCTTCTGGGGGCAATAGGG + Intergenic
972556066 4:40182356-40182378 CTTTTGTCCTGTAGGCAGTAGGG + Intergenic
973553573 4:52059283-52059305 GTTGTGTCCAGGAGGCACCAAGG + Intronic
973726468 4:53782009-53782031 ACTTTGTCCCGAAGGCACTTGGG - Intronic
974179520 4:58365419-58365441 AACTTGTCCTGAAGGCACTTGGG + Intergenic
974585781 4:63875124-63875146 ATTTTGAGCTGGAGTCACTCTGG - Intergenic
974831908 4:67200045-67200067 AATTTGTCCTGATGGCCCTAAGG - Intergenic
976611550 4:87035587-87035609 CTTTAGTCCTGTAGGCACCAGGG + Intronic
976777009 4:88718247-88718269 ATTGTGCCCCTGAGGCACTATGG + Intergenic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
979079339 4:116313792-116313814 CTTTTCTTCTGGAGGCTCTAGGG - Intergenic
981306023 4:143247714-143247736 AATTGTTCCTGAAGGCACTAAGG + Intergenic
982296565 4:153835131-153835153 CCTTTGTCCTGGAGGCAGTGCGG + Intergenic
983771558 4:171555911-171555933 GGTTTCTCCTGGAGGCCCTAGGG - Intergenic
986270235 5:6223803-6223825 TTTTTGTTCTGGAGGCCCCAGGG - Intergenic
986367888 5:7053195-7053217 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
986937016 5:12901674-12901696 ATTTTTTTCTGGAGACACCAGGG - Intergenic
987476878 5:18401479-18401501 TTTTTGGCCTGGAGGCAAGAGGG - Intergenic
988175683 5:27721666-27721688 ATTTATTTCTGGAGGCTCTAGGG - Intergenic
988388829 5:30600891-30600913 ACTCTGTCCTGGGGGCATTATGG - Intergenic
989087841 5:37694913-37694935 ATTTTATCCTGAAGGCAAAAGGG - Intronic
989975679 5:50583936-50583958 ATTTCCTTCTGGAGGCACTAGGG - Intergenic
991093714 5:62717916-62717938 ATTTTGACCTGAAGGCAATTGGG - Intergenic
991347705 5:65687492-65687514 TTTTTGTCCTGAAAGCACTGTGG - Intronic
992287171 5:75247691-75247713 GTTTTCTCCTGGAAGCAGTAGGG + Intergenic
993017426 5:82550924-82550946 TTTTTTTCCTGAATGCACTATGG + Intergenic
993998294 5:94748478-94748500 GTTTTGTCCTGTAGCCACAAAGG - Intronic
994097858 5:95863291-95863313 AGTTTGTCCTGGAGGTCCTAAGG + Intergenic
994660861 5:102652530-102652552 TTTTTGTCTTGGAGGCACTAAGG - Intergenic
996408714 5:123131939-123131961 ATTTTGTCTTTGAGGCACCCAGG - Intronic
997595943 5:135107552-135107574 ATTCTGTCCTGGTGGCACCTGGG + Intronic
1001236802 5:170036624-170036646 ATTTTATCCTGAAGGCAGCAGGG - Intronic
1001286753 5:170429285-170429307 ATTTTATCCTGTAGACACTGGGG - Intronic
1001371232 5:171205052-171205074 ATTTTGTCCTGAAGTTATTAAGG + Intronic
1001449195 5:171810967-171810989 ACTTTATCCTGGAAGCAGTAGGG - Intergenic
1004841233 6:19587337-19587359 ATTATGTTCTGGAGGCACTGGGG - Intergenic
1005367670 6:25095547-25095569 CTTTTATCCTGGAGGCACTAAGG + Intergenic
1007393489 6:41563883-41563905 AGTTTGTCCTGCAGGACCTATGG - Intronic
1007920998 6:45609477-45609499 ATTCCATCCTGCAGGCACTATGG - Intronic
1008407907 6:51139826-51139848 ATTTTGACCTGGTGGAAATACGG - Intergenic
1009871563 6:69459020-69459042 ATTTTGTGCTGGAAGCTCAATGG - Intergenic
1011131284 6:84054015-84054037 ATTGTGCCCTGGAGGCAGTGGGG + Intronic
1011823950 6:91284521-91284543 ATTTCTTTCTGGAGGCTCTAGGG - Intergenic
1012532206 6:100251557-100251579 ACTTTGTCATGAAGGCATTAGGG + Intergenic
1013288008 6:108697510-108697532 ATTTTCTCCTGGCAGCACTAAGG + Intergenic
1013643567 6:112112445-112112467 ATTTAATCCTGGAGGCTCTTGGG + Intronic
1014005753 6:116415989-116416011 ATTTTATTCTGGAAGCTCTAGGG + Intronic
1014756328 6:125305211-125305233 ATTTCCTCCTGGAAGCTCTAGGG - Intergenic
1015070362 6:129086831-129086853 ATTTCTTTCTGGAGGCTCTAAGG + Intronic
1015124421 6:129737005-129737027 ATTTTTTTCTGGAAGCTCTAGGG - Intergenic
1015638591 6:135305741-135305763 ATTTTATCCTGAAGGTAGTAAGG - Intronic
1015700290 6:136028542-136028564 ATTTCTTTCTGGAGGCTCTAAGG + Intronic
1016282314 6:142432267-142432289 ATTTTGTCCTGGAGGAATTTTGG + Intronic
1017162823 6:151381584-151381606 ATTTTATCCTAGTGGCAGTAAGG - Intronic
1020689988 7:11342181-11342203 CCTTTGTCTTGGAGGCACAATGG + Intergenic
1020707133 7:11559195-11559217 ATTTCTTTCTGGAGGCTCTAGGG - Intronic
1022255508 7:28653269-28653291 TTTTTCTCCTTGAGGCACTTTGG + Intronic
1022381674 7:29866362-29866384 ATTTTGCCCTGCAGCCAATAGGG + Intronic
1022970270 7:35510685-35510707 ATTTTGTCCAGGATGCAGCAGGG + Intergenic
1025937781 7:66050974-66050996 ACTGTGTCCTGGAGGCTCCATGG + Intergenic
1028148693 7:87346926-87346948 ATTCTTTTCTGGAGGCTCTAGGG + Intronic
1028530595 7:91833816-91833838 ATCTTATCCTGGAGGTAGTAAGG - Intronic
1028665378 7:93337321-93337343 CATTTGTGTTGGAGGCACTAAGG + Intronic
1029234133 7:99099171-99099193 ACTTTGCCCTGGAGGCAATGAGG + Intronic
1031441737 7:121802983-121803005 ATTTTTTCCTCTAAGCACTAGGG - Intergenic
1033889123 7:145986583-145986605 TTTTTTGCCTGGAGGCTCTAGGG - Intergenic
1036294514 8:7525169-7525191 ATTCTGTCCAGGAATCACTAAGG - Intergenic
1036328048 8:7795822-7795844 ATTCTGTCCAGGAATCACTAAGG + Intergenic
1037676114 8:21052044-21052066 GATTTCTCCTGGAGGCAGTAAGG - Intergenic
1037988255 8:23303027-23303049 ATCTTGTCCAGGAGGCCCTGTGG + Intronic
1038251157 8:25906309-25906331 CTTTGGTCATGGAGGCACTTTGG + Intronic
1039114393 8:34075977-34075999 CTTTTCTCCTGAAGGAACTAAGG + Intergenic
1039647898 8:39307134-39307156 ATTTTGTTATAGAAGCACTAAGG - Intergenic
1039817476 8:41107226-41107248 ATTCTTTCCTGAAGGCTCTAGGG - Intergenic
1041186798 8:55309079-55309101 GTTTCTTCCTGGAGGCTCTAGGG - Intronic
1041404518 8:57483401-57483423 TATTTGTCCTGGAGCCACTGGGG - Intergenic
1041707270 8:60859825-60859847 ATTTTGTCCTGGAGGTAATAGGG + Intronic
1041867274 8:62590094-62590116 ATTTAGGCCTGCAGTCACTATGG - Intronic
1042193111 8:66208273-66208295 ATTGTCTCCTAGAGTCACTATGG + Intergenic
1043283108 8:78494194-78494216 ATTTCTTGCTGGATGCACTAAGG - Intergenic
1044057439 8:87588636-87588658 ATTCTGTTCTGTAGGCACCAGGG + Intronic
1044274918 8:90287890-90287912 ATTTTGTCCTGGTTGCATTATGG + Intergenic
1044472745 8:92589475-92589497 ATTTTGTTCTGAAGCCACCACGG + Intergenic
1045634311 8:104165871-104165893 ATGGTGTCGTGCAGGCACTATGG + Intronic
1045920195 8:107520414-107520436 ATTGTGTCCTGGAGTCATTTTGG + Intergenic
1046124275 8:109884720-109884742 ATTCTTTTCTGGAGGCCCTACGG + Intergenic
1047449358 8:124949878-124949900 ATTGCTTCCTGGAGGCTCTAAGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050275951 9:4000638-4000660 ATTTTGTCCTGTAAGCAGCAGGG - Intronic
1051741756 9:20259170-20259192 AATTTTTCCTGGAGGCTCTAGGG - Intergenic
1052498799 9:29261891-29261913 ACATTGTCCTGGATGCACAATGG - Intergenic
1053075261 9:35127630-35127652 ATTTTGTCCTAGCTGAACTATGG + Intergenic
1055485947 9:76756611-76756633 ATTGTGTCCTGAAGGCACTGTGG + Intronic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1057487638 9:95498497-95498519 ATTCCCTCCTGGAGGGACTAAGG + Intronic
1057877829 9:98771364-98771386 ATTTTGTCCTGGATGTGCTGAGG - Intronic
1058095615 9:100856984-100857006 ATTTTTTTCTGGAGGCTCTAGGG + Intergenic
1058116101 9:101085750-101085772 ATGTGGTACTGGAGGCACTGGGG + Intronic
1058896628 9:109406052-109406074 ATTTTGTCGGGGAGGCAGTGAGG - Intronic
1058915122 9:109558093-109558115 ATTTCTACCTGCAGGCACTAGGG - Intergenic
1059187405 9:112287291-112287313 ATTTTGTCCAGAAGTTACTAAGG + Intronic
1059874627 9:118620596-118620618 ATTTTGCCCTGCAGGAGCTAGGG + Intergenic
1060294758 9:122335911-122335933 ATTTTTTCCTGGAGGTCATAGGG - Intergenic
1060297276 9:122351271-122351293 GTTTTGTCCTGGGGGTAATAGGG - Intergenic
1060543534 9:124447491-124447513 ACTTTCTCCTGGAGGCACTAGGG + Intergenic
1061559085 9:131391237-131391259 ATTTTCTTCTGGAGGCTTTAGGG + Intergenic
1061751800 9:132783311-132783333 ATTCCTTCCTGGAGGCTCTAGGG - Intronic
1062071680 9:134558779-134558801 ATGGTGTCCTGGAGGCTCTCTGG + Intergenic
1185536785 X:868885-868907 AGTTCCTCCTGGAGGCTCTAGGG + Intergenic
1185808994 X:3087667-3087689 AGTTTCTTCTGGAGGCTCTAGGG + Intronic
1187456572 X:19446554-19446576 ATTTTGTTCTGTAGTCCCTAGGG - Intronic
1187956441 X:24523484-24523506 AGATTGTCCTGGAGGGACTCTGG + Intronic
1188765644 X:34088179-34088201 AGTTTGTCCTGGAGCCATCAGGG - Intergenic
1188897222 X:35684345-35684367 ATTTCTTTCTGGAGGCACTAAGG - Intergenic
1189124505 X:38431990-38432012 AATTTTTCCTGCAGGCACTGGGG + Intronic
1189533913 X:41916383-41916405 TTTCTGTCCTGGAGCCACTATGG - Intronic
1190653917 X:52594364-52594386 ATTTTGTGCTGGACACTCTAGGG - Intergenic
1192017647 X:67348865-67348887 ATTTTTTCATGGAGGCAAAATGG - Intergenic
1192477480 X:71455527-71455549 TTTCTGTATTGGAGGCACTATGG + Intronic
1193276221 X:79590798-79590820 ATTTTCCCCTGGAGTCACTGGGG + Intergenic
1196981459 X:121218612-121218634 ATTTTTTCCTGGAGTTTCTATGG + Intergenic
1197873268 X:131080080-131080102 ACTTTTTCCTGAAGGCAATAGGG - Intronic
1198200601 X:134413849-134413871 ATTTAGGCCTGGTGTCACTAGGG - Exonic
1198377348 X:136052950-136052972 TGTTTGTTCTGGAGGCTCTAGGG - Intergenic
1198412847 X:136389217-136389239 ATTTTGCCCAGGAGGCAGGAAGG - Intronic
1199402503 X:147415525-147415547 ATTTTTTTCTGGAAGCTCTAGGG + Intergenic