ID: 952470491

View in Genome Browser
Species Human (GRCh38)
Location 3:33645222-33645244
Sequence GCGTGCTAGAAGATACACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952470491 Original CRISPR GCGTGCTAGAAGATACACTA TGG (reversed) Intronic
903094186 1:20953966-20953988 GAGTGCTAAAAGAGACAATATGG + Intronic
908859314 1:68465198-68465220 GTGTGAGAGAAGAAACACTAGGG + Intergenic
909531627 1:76688368-76688390 GCATTCTAGAAGAAACACTCAGG + Intergenic
915110095 1:153558719-153558741 GGTTGCTAGAAGACAGACTATGG + Intergenic
916659828 1:166912849-166912871 GCCTGCTAGAAATTACACTTGGG - Exonic
1103191569 12:119006307-119006329 GTGTGTGAGAAGAGACACTAGGG + Intronic
1108932734 13:55848837-55848859 GAGTGCTAGAACATACACTGTGG + Intergenic
1112968780 13:105233293-105233315 GCGTGCTAAAACATCCAGTAAGG - Intergenic
1118908080 14:70037536-70037558 ACATGCTAGCAGAAACACTATGG - Intergenic
1124130655 15:26982546-26982568 GCTTGCAAGAAGATATATTAAGG + Intronic
1131385503 15:92003367-92003389 GCTTCAGAGAAGATACACTATGG + Intronic
1149879093 17:60269960-60269982 GAATACTCGAAGATACACTATGG + Intronic
931086245 2:58833764-58833786 GCAGGCTACAAGATACAATAAGG + Intergenic
935085739 2:99842982-99843004 GAGTGCTTGAAGATAAACAAAGG - Intronic
936084730 2:109459526-109459548 GCGTGCTAGGAGACACCCCAAGG + Intronic
938042676 2:128089016-128089038 GAGGGCTAGAAAATACACTATGG + Intergenic
1182997388 22:34826677-34826699 GCATGGTAGAAGAAGCACTAGGG + Intergenic
1185057990 22:48591288-48591310 CCCTTCTAGAAGATTCACTAAGG - Intronic
949771566 3:7585040-7585062 GCATGCTAGAAGAGAAAATATGG - Intronic
952470491 3:33645222-33645244 GCGTGCTAGAAGATACACTATGG - Intronic
955041002 3:55317807-55317829 TCATGCTAGGAGATGCACTAGGG + Intergenic
957537130 3:81521025-81521047 GCAAGGTAGAAGAAACACTAAGG - Intronic
965667356 3:171109535-171109557 GGGTGTTAGGAGATAAACTAAGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
985322028 4:188723824-188723846 GCGAGAAAGAAGAAACACTATGG - Intergenic
992750481 5:79856664-79856686 GCGTGCTAGAAGAACCTCTCTGG + Intergenic
1001158115 5:169290585-169290607 ACATGCTAGGACATACACTAGGG + Intronic
1010009227 6:71030979-71031001 GGGTGCTAGAAGATACTGAACGG - Intergenic
1027940421 7:84671620-84671642 GCCTGCTTGAAGATATACTGTGG - Intergenic
1036473632 8:9073394-9073416 GCGTGAGAGAAGATACAGTTGGG + Intronic
1056372645 9:85972706-85972728 GCTAGCTACAACATACACTAGGG - Intronic
1190559905 X:51676991-51677013 GTGTGCAAGAAGATATACTCAGG + Intergenic
1190564386 X:51716330-51716352 GTGTGCAAGAAGATATACTCAGG - Intergenic
1190922860 X:54872810-54872832 GCGGGCTTGAAGATAGACAAGGG - Intergenic
1198617270 X:138473077-138473099 GGGTGCTAGATAATAGACTATGG - Intergenic