ID: 952472479

View in Genome Browser
Species Human (GRCh38)
Location 3:33671014-33671036
Sequence AAACTAGAGCAGCAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952472479_952472483 -6 Left 952472479 3:33671014-33671036 CCCATCTCCTGCTGCTCTAGTTT 0: 1
1: 0
2: 3
3: 26
4: 230
Right 952472483 3:33671031-33671053 TAGTTTTCCACGTGGAGAAATGG 0: 1
1: 0
2: 0
3: 32
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952472479 Original CRISPR AAACTAGAGCAGCAGGAGAT GGG (reversed) Intronic
900421158 1:2556497-2556519 GAACCCGAGCAGCAGGAGAGTGG - Exonic
900511976 1:3065086-3065108 AGACTTGAGCAGCAGGAGCCAGG - Intergenic
900724164 1:4204183-4204205 TCACTGGAGTAGCAGGAGATGGG + Intergenic
901033326 1:6321219-6321241 AACCTAGACAAGCAGGAGGTGGG - Intronic
901122451 1:6906641-6906663 AAATTGGAGCAACAGGAGCTTGG + Intronic
901641093 1:10693617-10693639 AACCGAGAGGAGCAGGAGCTGGG - Intronic
903513413 1:23893503-23893525 AAACTAATTAAGCAGGAGATTGG + Intronic
903580034 1:24364030-24364052 AAACGGAAGCAGCAGGACATGGG - Intronic
903955251 1:27021155-27021177 AAACCAGAGAAGGAGGGGATGGG - Intergenic
904310883 1:29628808-29628830 GAACTAGAGCAGAAGGGGAGGGG + Intergenic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
906262249 1:44402820-44402842 AACATTGAGCAGCAAGAGATAGG - Intergenic
907612797 1:55889369-55889391 AAAATAGAGGAGCAAGAGGTTGG - Intergenic
909207269 1:72775142-72775164 AAGGGAGAGTAGCAGGAGATGGG + Intergenic
909434686 1:75627311-75627333 TAACAAGAGCAGTAGGGGATAGG + Intergenic
909454922 1:75839548-75839570 AAAGTAGAGCAGCAGGGCATAGG + Intronic
911509149 1:98790421-98790443 AACATACAGCAACAGGAGATTGG - Intergenic
912400827 1:109390424-109390446 AAACTAGAGCAGCAGCTCTTAGG - Intronic
915921850 1:159981693-159981715 AAAATATAGCAGCAGGAGGCTGG - Intergenic
915953229 1:160204303-160204325 AACCCAGAGCAGCAGGAACTTGG + Intergenic
918192523 1:182189476-182189498 AAATTAAAGCAGCAGCACATTGG - Intergenic
918295281 1:183150258-183150280 AAACAAGGGCAGCGGGAGAGGGG - Intergenic
919569667 1:199231583-199231605 AAATAAGAGGAGCAGGAGAATGG + Intergenic
919886160 1:201936491-201936513 AAACTAGAGCAGGAGGAGTGGGG - Intronic
919930622 1:202219107-202219129 CAACAAGAGAAGCAGGTGATGGG - Intronic
921717585 1:218434143-218434165 AAACAAGAGCAGAAGGCGAATGG + Exonic
921718410 1:218443459-218443481 AAACTGGAAAAGCAAGAGATGGG + Exonic
922610753 1:226925299-226925321 AAACTAGAGAAGCAGCAAACAGG - Intronic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1067642962 10:48068047-48068069 AACCCAGAGCAGCAGGAGCCAGG + Intergenic
1067824525 10:49560466-49560488 AAACTTGAACAGCATGAAATGGG + Intergenic
1067912617 10:50361687-50361709 AAACTAAAGCAGAAGCAAATGGG - Intronic
1068498569 10:57816356-57816378 AAAGTACAGCAGCAGGTGTTGGG - Intergenic
1070407880 10:76112666-76112688 TACCTAGTGCAGTAGGAGATGGG - Intronic
1070956159 10:80464878-80464900 GAACTAGAGAAGGAGGAGAGTGG + Intronic
1071745408 10:88413173-88413195 CTACTAGAGCAGAAGGATATGGG - Intronic
1072439954 10:95445585-95445607 AACCTTGACCAGCAGAAGATGGG + Intronic
1074660502 10:115650622-115650644 AAACTAGAGAGGAAGGGGATTGG + Intronic
1074968963 10:118519870-118519892 AAACTAAAGCTGAAGGAGAGAGG + Intergenic
1076219005 10:128718065-128718087 AGACAAGAGCAGCAGGAGCCAGG - Intergenic
1077708218 11:4509234-4509256 ACATCTGAGCAGCAGGAGATAGG + Intergenic
1078101050 11:8330495-8330517 AAACTTTAGCAGCTGCAGATGGG - Intergenic
1078371906 11:10754355-10754377 CAACTAGATAAGCAGCAGATTGG + Intronic
1079161833 11:18002238-18002260 AAACTAAAGCAGCAACAGTTGGG - Intronic
1080290171 11:30662077-30662099 AAGAGAGATCAGCAGGAGATGGG - Intergenic
1081692275 11:45086601-45086623 AGACTAGAGCAGGAGGTGCTGGG - Intergenic
1082711188 11:56555490-56555512 AAACTAGAGAGGAAGAAGATGGG + Intergenic
1083104682 11:60346416-60346438 AAACTACAGCAGCAGGTGATAGG - Intronic
1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG + Exonic
1084371652 11:68749322-68749344 AAGCCAGAGCAGCAGGAGCTTGG - Intronic
1088283875 11:108165733-108165755 AGACTAAAGCAGGAGGAGAGTGG - Intronic
1089497905 11:118916931-118916953 AGAGCAGAGCAGCAGGGGATGGG + Intronic
1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG + Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1095640217 12:44478487-44478509 AAACTACAGAAGCAGGCTATAGG + Intergenic
1095698872 12:45170663-45170685 AAAGCAGAGAAGCAGGAGATTGG + Intergenic
1096493651 12:52026803-52026825 AAACTAGGCCTGCAGGAGCTAGG + Intronic
1097799077 12:63893092-63893114 TAACTATAGCAGCAAAAGATTGG - Intronic
1099421431 12:82466883-82466905 AAAATTGAGCAGGAGTAGATTGG - Intronic
1099988189 12:89693848-89693870 AAAGTAGAGAACCAGGAAATTGG - Intronic
1100461146 12:94800513-94800535 AAACAAGAGCAGCACCAGAAAGG + Intergenic
1101687088 12:107035722-107035744 AAAATAGAGTAGAAGGATATCGG + Intronic
1101750042 12:107576081-107576103 AACCTAGTGCAGTAGGGGATGGG - Intronic
1102641614 12:114371950-114371972 ACACTACACCAGCAGGAGAAGGG + Intronic
1103135784 12:118506348-118506370 AACCCAGAGAAGCAGCAGATGGG + Intergenic
1104147646 12:126050855-126050877 AGACTAGAGGAACAGGAGCTGGG - Intergenic
1106934291 13:34701382-34701404 AAACCAGGGCAGCTGGAGGTGGG + Intergenic
1107730290 13:43341686-43341708 AAACTAGAGTAGAAGTAGAAAGG + Intronic
1112509368 13:99996275-99996297 CAACTAGATCATCAGGAGCTGGG - Intergenic
1114764031 14:25350222-25350244 AAAGCAGAGCAGCAGGAGCTGGG - Intergenic
1114870680 14:26652607-26652629 AAACTAGAGATCCAGGAGAGCGG - Intergenic
1115401637 14:32968081-32968103 AGACTAGAGGGGCAGGGGATGGG + Intronic
1119416270 14:74472036-74472058 ACACTGGAGCAGCAGGAAAACGG + Intergenic
1119704771 14:76776711-76776733 ACACTTGAGCAGGAGGTGATAGG + Intronic
1121494118 14:94380256-94380278 GAACTAGATCAGCAGGGCATGGG + Intronic
1121777082 14:96598152-96598174 AACCTAGAGGGGCAGGAGAAAGG - Intergenic
1121777124 14:96598285-96598307 AACCTAGAGGGGCAGGAGAAAGG - Intergenic
1121777165 14:96598399-96598421 AACCTAGAGGGGCAGGAGAAGGG - Intergenic
1123065219 14:105615618-105615640 AACTGAGAGCAGCAGCAGATAGG + Intergenic
1123069417 14:105635054-105635076 AACTGAGAGCAGCAGCAGATAGG + Intergenic
1123962039 15:25413527-25413549 AAACTAAAGCAGGAGGACTTAGG - Intronic
1124125986 15:26938330-26938352 AAAGTAGTGCAGCAGGAGTTTGG + Intronic
1125581687 15:40790211-40790233 CAATTAGAGCAACAGGAGACGGG - Intronic
1127450760 15:59114142-59114164 AAGGGAGAGAAGCAGGAGATGGG + Intronic
1127660502 15:61096049-61096071 AAGTGAGAGGAGCAGGAGATTGG + Intronic
1129068749 15:72933425-72933447 AAATTTGAGCAGCAGGACAGGGG - Intergenic
1130123378 15:81071314-81071336 AGAATAGAGCATCAGGACATGGG + Intronic
1130795197 15:87200351-87200373 AAAGGAGAGCAGCAGGAGTAGGG + Intergenic
1134323379 16:13184294-13184316 AAAGTACAGCTGCAGAAGATAGG - Intronic
1134822694 16:17259293-17259315 AAGCTGGAACAGCAGGAGAAAGG - Exonic
1136994028 16:35175462-35175484 AAAGTAGAGTAGCAGCAGCTGGG + Intergenic
1137651577 16:50124985-50125007 AGACTTGAGCAGCAGGAAGTGGG + Intergenic
1138723098 16:59104944-59104966 AAACAGGAGCAAGAGGAGATGGG - Intergenic
1139347953 16:66316571-66316593 GAACTAGAGCAGCAGCAGGAAGG + Intergenic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1140880247 16:79191660-79191682 AAACTAGAGAAGCACCAAATAGG + Intronic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1147344198 17:39777073-39777095 AAAATACAGCAGAATGAGATGGG - Intronic
1148764254 17:50028212-50028234 AAGCTGGGGCAGCAGGAGAGGGG - Intergenic
1152204907 17:78969432-78969454 AAAATAGAGGTGGAGGAGATAGG + Intergenic
1153777735 18:8468483-8468505 AAAATAGAACAGCAGGTGAAAGG + Intergenic
1154336909 18:13473281-13473303 CAACTAGAGAAGCTGGAGATGGG - Intronic
1154372841 18:13780315-13780337 TAACCAAAGCAGCAGGATATTGG + Intergenic
1157528104 18:48400487-48400509 AAACTAGGGAAGCAGCAGAGGGG - Intronic
1159484242 18:69033443-69033465 GAACTAGGGCAACAGGAGAATGG - Intronic
1162336179 19:10061937-10061959 CTACTAGAGAAGCAGGAGCTGGG + Intergenic
1164053125 19:21599834-21599856 AAACTTGAGGAGCAGGTTATGGG - Intergenic
1164187129 19:22880288-22880310 AAACTGCAGAAGCAGGATATAGG + Intergenic
1166517913 19:43461199-43461221 AAACCAGCGCAGCAGAAGCTGGG + Exonic
925373114 2:3361904-3361926 AAAGAAGAGCAGGAGGCGATTGG - Intronic
926552011 2:14312322-14312344 ACAACAGAGCAACAGGAGATGGG + Intergenic
927766797 2:25817707-25817729 AAACTAGAACAGCAGGTAAGAGG + Intronic
928004655 2:27553346-27553368 GAACTGAAGGAGCAGGAGATGGG - Intronic
930155126 2:48099035-48099057 AAACTACACCAGCAGGTGACTGG - Intergenic
930254139 2:49069444-49069466 AAATTAAAGCAGCAGGAAAGAGG - Intronic
931583672 2:63804702-63804724 AATCTAGACCATCAGGAGATAGG - Intronic
932421194 2:71602450-71602472 AGAGAAGAGCAGCAGGTGATGGG - Intronic
933557230 2:83846063-83846085 AAACCAGAGCAGCAAGAGGATGG - Intergenic
934781206 2:96970775-96970797 AAACTGGAGAAACAGGACATGGG + Exonic
939123914 2:138152261-138152283 ACACTAGAGAAGCAGGAAAGGGG - Intergenic
942517429 2:176768593-176768615 AAACAACAGCAGCAGGAGTTCGG - Intergenic
944008935 2:194948006-194948028 TAAATAAAGCAGCAGCAGATAGG - Intergenic
945169242 2:206978824-206978846 GGACTAGAGCTGCAGGGGATGGG - Intergenic
945617532 2:212091369-212091391 AAACTAAAACATCAGGTGATTGG + Intronic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946702545 2:222427014-222427036 AAACTATAGCAGGGGGAGCTAGG - Intronic
948698690 2:239747351-239747373 AAGCCAGAGCAGCAGGGGACAGG - Intergenic
1169884563 20:10383983-10384005 AAACTTGACCAGCAGGAAACAGG - Intergenic
1172200668 20:33123996-33124018 ACATGTGAGCAGCAGGAGATGGG + Intergenic
1172856491 20:38007731-38007753 GAGCAAGAGCAGCAGCAGATGGG + Intronic
1173332853 20:42089684-42089706 AGACTACAGCAGCAGCAGAATGG + Intronic
1175515869 20:59569411-59569433 AAACAAAGGCAGCAGGAGAGAGG + Intergenic
1178880873 21:36449218-36449240 AAACAAGAGCAGCATGTGAGAGG - Intergenic
1179611003 21:42549992-42550014 AAAATACATCAGCAGGAGGTGGG - Intronic
1183485211 22:38084677-38084699 AAATGAGAGCAGGTGGAGATGGG + Intergenic
1184385528 22:44172256-44172278 AACCAAGAGCAGCAGCAGACGGG - Intronic
949718179 3:6957691-6957713 ACAATAGAGCAGTAGGGGATGGG - Intronic
950922387 3:16707697-16707719 AACCTAAAGCAGAAGGAGAGTGG + Intergenic
951896766 3:27616948-27616970 AAAATACAGGAGCAGGAGAAGGG - Intergenic
952472479 3:33671014-33671036 AAACTAGAGCAGCAGGAGATGGG - Intronic
952606907 3:35158669-35158691 AAATTATATCAACAGGAGATGGG + Intergenic
957907029 3:86570219-86570241 AGACCAGAGCAGAAGGAGATTGG + Intergenic
959533182 3:107456736-107456758 AAAATAATACAGCAGGAGATTGG + Intergenic
959597034 3:108140043-108140065 AAACCAGAGAAACAGGAGCTGGG - Intergenic
960550364 3:118969584-118969606 GAACTAGAGCAGCAGGTACTAGG + Intronic
961672195 3:128541455-128541477 AAACTATATCAGGAGGAGAAAGG - Intergenic
962665160 3:137647189-137647211 AAATTAGAACACCAGGCGATTGG + Intergenic
964636628 3:158864974-158864996 ACACTTGTGCATCAGGAGATAGG + Intergenic
967544531 3:190709018-190709040 AAAATAGGGCAGCAGAATATAGG - Intergenic
968222241 3:196947772-196947794 GAAGTAGAGGAGAAGGAGATAGG + Exonic
968893268 4:3383889-3383911 AAACTTGAGAACCAGGAGAGAGG - Intronic
969228780 4:5815680-5815702 AAACCAGAGGAGTGGGAGATGGG + Intronic
970133977 4:12902099-12902121 AAACTAGGGCAGTAGCAGAAAGG - Intergenic
970337198 4:15060602-15060624 AAACTGGAGAAGGAGCAGATAGG + Intronic
970873232 4:20840826-20840848 AAAGTTGAGCGGAAGGAGATGGG - Intronic
971292647 4:25359138-25359160 AAACCTGGGCAGCAGTAGATGGG + Intronic
972411075 4:38795422-38795444 AAAGTAGAGCATGAGCAGATGGG - Intronic
975512092 4:75205393-75205415 ACAATGGAGAAGCAGGAGATGGG - Intergenic
976028253 4:80718362-80718384 AAACTACAGAAGTAGGAGAAAGG + Intronic
976311011 4:83613573-83613595 AAACTATAGCAAGAAGAGATGGG - Intergenic
981575752 4:146203269-146203291 AAACAAAACCAACAGGAGATAGG + Intergenic
981753492 4:148117126-148117148 ACACAAGAGCAGCGGGAGATGGG + Intronic
982456253 4:155612321-155612343 CAGCTAGAGCAGCAGGAGCAAGG - Intergenic
982742792 4:159075063-159075085 AGAGTACATCAGCAGGAGATGGG - Intergenic
982895801 4:160923259-160923281 AAACTATAGCAGCAGAAAACAGG - Intergenic
983534656 4:168844640-168844662 AAAGTTGTGCAACAGGAGATTGG + Intronic
984396439 4:179207405-179207427 TAACTAGACCAGTAAGAGATCGG + Intergenic
985784900 5:1888252-1888274 AAGCTGGAGCAGCAGGTGACCGG + Intergenic
986009120 5:3696187-3696209 GAACTAAAGCAGCAAGAGACAGG + Intergenic
989661816 5:43807956-43807978 AAATCAGAACAGCAGGAGACAGG - Intergenic
989755707 5:44950639-44950661 AAAGTAGATCAGCAGAATATGGG + Intergenic
990147310 5:52776451-52776473 AAGTTACAGCAGCAGGAGTTTGG - Intergenic
990527128 5:56638956-56638978 AGACAAGATCAGCAGGAGAAGGG - Intergenic
991547679 5:67801458-67801480 AAAATAGATTTGCAGGAGATGGG - Intergenic
991633621 5:68681277-68681299 AAACTAAAGCAGTCAGAGATCGG - Intergenic
992018936 5:72603523-72603545 GAACCAGAGCAGAAGGAGACAGG + Intergenic
992199123 5:74367102-74367124 ACACTCGTGCAGCAGGAGATTGG + Intergenic
993028907 5:82680601-82680623 AAAGAAGAGCAGCAGAAGTTAGG + Intergenic
994368645 5:98945208-98945230 TTACTAGAGCAGCAGCATATAGG - Intergenic
995762313 5:115576452-115576474 AAACTAGAAAAGCAGGAAAATGG - Intergenic
995909824 5:117173045-117173067 AAATTATAGCAGCAGAAGAAAGG - Intergenic
998094932 5:139391631-139391653 GAACGGGAGCAGCAGGAGACAGG - Exonic
998282092 5:140821807-140821829 AAGCCAGAGCAGCAGGAGCCGGG - Exonic
999270680 5:150294814-150294836 AAACTTGGGCCACAGGAGATGGG + Intergenic
999675261 5:153994190-153994212 AAACTAGAGAAGTAAGAGTTTGG + Intronic
1000954198 5:167523038-167523060 AAAATGGAGCAGAGGGAGATGGG - Intronic
1000989556 5:167898031-167898053 AACCCAGATCAGCAGGAGGTAGG - Intronic
1001721744 5:173862542-173862564 AAAATAGGGCAGAAGGTGATGGG + Intergenic
1003220257 6:4154885-4154907 ACTCTAGAGAAGCAGGTGATTGG - Intergenic
1003983664 6:11414097-11414119 AAACAAGAGAAGCAGTAGAGAGG - Intergenic
1005225348 6:23636088-23636110 AAATTAGAGGAGCAGCAGAAAGG + Intergenic
1006365054 6:33610374-33610396 AGGCTAGAGCAGTAGGGGATGGG - Intergenic
1006804385 6:36778733-36778755 TCTCTAGAGCAGAAGGAGATGGG + Intronic
1007335997 6:41155626-41155648 AGACTACAGCAGCTGGGGATGGG + Intergenic
1009035535 6:58113422-58113444 AAACTAGTGAAGCAGGAGCAGGG - Intergenic
1009211355 6:60867016-60867038 AAACTAGTGAAGCAGGAGCAGGG - Intergenic
1009300703 6:62015355-62015377 AGCCAAGAGCAGCAGGACATGGG - Intronic
1009651427 6:66481372-66481394 AAACCCGGGCAGCAGTAGATGGG - Intergenic
1011099212 6:83703541-83703563 AAATTAAAGCAGCAGGAATTTGG + Intronic
1011961893 6:93101041-93101063 AGACTGGAGCAGAGGGAGATAGG + Intergenic
1014747293 6:125214772-125214794 AAACTACAGCAGCATGAAATTGG - Intronic
1015579292 6:134705870-134705892 GAACTAGAGCAGTAGGAGTCAGG + Intergenic
1018479286 6:164173825-164173847 AACCTAGAGCAGGTGGAGATTGG + Intergenic
1018621508 6:165733352-165733374 ACACAAGGGCAGCAGGAAATAGG - Intronic
1019853871 7:3585084-3585106 AAACTAGGGCAGCAGGATGTAGG - Intronic
1020558311 7:9697229-9697251 AAACTTGAACATCAGGAGATGGG - Intergenic
1022299598 7:29090631-29090653 AAACAATGGCAGAAGGAGATTGG + Intronic
1024223632 7:47307174-47307196 AAACCAGATGAGCAGGAGAAGGG - Intronic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1025776621 7:64566823-64566845 AGATTATAGAAGCAGGAGATGGG - Intergenic
1026592687 7:71710730-71710752 AGACCAGAGCAGCAGGGGAATGG - Intronic
1026876305 7:73880952-73880974 AAACTAAAGGCTCAGGAGATTGG - Intergenic
1029787754 7:102809765-102809787 AAACTACATCACCAAGAGATAGG - Intergenic
1030026515 7:105329627-105329649 AACAAAGAGCAGCAGAAGATGGG + Intronic
1032544175 7:132728057-132728079 AGACTAAAGCAGCAGAAGTTTGG + Exonic
1033009012 7:137599202-137599224 AAAGGAGAGAAGCAGGATATGGG + Intronic
1033835298 7:145303148-145303170 AACCTAGACCAGCAGCAGAGGGG + Intergenic
1035717515 8:1764727-1764749 AACCTAGAGCAGCTGGCTATAGG - Intronic
1038889313 8:31700874-31700896 TAACTAGAGCAAGAGTAGATGGG + Intronic
1040439173 8:47423309-47423331 AAAATAGAGCAGCAAGAGCCAGG + Intronic
1040560669 8:48520885-48520907 AAAGTAGAGCAGGTGGAAATTGG + Intergenic
1040946874 8:52893642-52893664 AAACTACGGCACCAGGAGGTGGG - Intergenic
1042689681 8:71484263-71484285 AAACAAGAGAAGCAGAACATTGG + Intronic
1043889710 8:85642632-85642654 AAACTGGAGCAGCAGGCGGCAGG - Intergenic
1045594810 8:103641520-103641542 AAGCTATAGCATCACGAGATTGG - Intronic
1046893849 8:119451559-119451581 TAGGTAGAGCAGTAGGAGATGGG - Intergenic
1048468778 8:134688834-134688856 AACCGAGAGCTGCAGGAGGTGGG + Intronic
1050303787 9:4286067-4286089 AAGCCAAAGCAGCAGGAGTTTGG - Exonic
1051746381 9:20298791-20298813 AGAGTTGAGCAGCAGGAGAGAGG + Intergenic
1052929788 9:34047020-34047042 AAACCAGAGCAGCAGGAAACAGG + Intronic
1053100857 9:35371207-35371229 AAACTAGTGGAGCAGGAAATGGG - Intronic
1054907409 9:70422931-70422953 CAACTTGATAAGCAGGAGATGGG - Intergenic
1055812830 9:80169958-80169980 AGACTTGAGGAGAAGGAGATGGG + Intergenic
1057878359 9:98774534-98774556 AACCTAGAGGAGCAGGACATGGG + Intronic
1059208698 9:112490212-112490234 AAAATAGAGAAGCTGAAGATTGG + Intronic
1060931239 9:127490836-127490858 GAACTTGACCAGCAGGAGACTGG + Intronic
1061153927 9:128845760-128845782 AAAGAAGAGGAGCAGGAGGTGGG + Intronic
1186922370 X:14296209-14296231 AAACAAGAGCAGGAGAGGATTGG + Intergenic
1187692911 X:21889332-21889354 AAGTTAGAACAGAAGGAGATAGG + Intergenic
1187787806 X:22912770-22912792 AAAGTAGAACAGCTGCAGATGGG - Intergenic
1188101321 X:26091518-26091540 AAATTGAACCAGCAGGAGATTGG + Intergenic
1188297495 X:28467801-28467823 AAACTAGAGCAGCAGGAATTTGG - Intergenic
1189271653 X:39756143-39756165 AAACTGGGGCGCCAGGAGATGGG + Intergenic
1189783682 X:44540582-44540604 GAGACAGAGCAGCAGGAGATAGG - Intronic
1190443260 X:50496904-50496926 TAACTAGGGCAGCAGGAGAGAGG + Intergenic
1191010440 X:55751849-55751871 TAACTAGATCAGTAGGAGAAAGG - Intronic
1191195979 X:57723510-57723532 AAACAAGACAAGCAGAAGATTGG - Intergenic
1191615821 X:63168499-63168521 AAAATAGAGCAGCAAGAGTTTGG + Intergenic
1191620477 X:63210424-63210446 AAAATAGAGCAGCAAGAGTTTGG - Intergenic
1193239701 X:79153390-79153412 AAACTGGAGCAGCAGGAAATGGG + Intergenic
1193433710 X:81445300-81445322 AAAATAAAGCAGCATGAGAGAGG - Intergenic
1194388408 X:93286497-93286519 AAACTAGAGCATTAGTAGGTAGG + Intergenic
1194391487 X:93322643-93322665 AAACTGCAGCTGCAGGAGGTGGG + Intergenic
1195283826 X:103363066-103363088 AAACTATAGATGCAGAAGATAGG - Intergenic
1197411801 X:126124701-126124723 AACCTAGAGCAGCTTCAGATTGG - Intergenic
1197804257 X:130384362-130384384 CAACTAGATCAGCAGGAGCTAGG - Intergenic
1197959277 X:131986371-131986393 AAATTAGAGCTTCAGGTGATTGG + Intergenic
1199031285 X:143003516-143003538 TAACTAGTGAAGCAGAAGATAGG + Intergenic
1199394394 X:147317615-147317637 AAACAACAACAGCATGAGATTGG - Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic