ID: 952475848

View in Genome Browser
Species Human (GRCh38)
Location 3:33709816-33709838
Sequence CACAACATGTGGCTGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952475848 Original CRISPR CACAACATGTGGCTGTTATT TGG Intronic
902988157 1:20168308-20168330 CCCAACATGTGTCTGGTCTTTGG + Intronic
903691414 1:25176589-25176611 CACAACATGTGGGAATTATGGGG - Intergenic
906958678 1:50399494-50399516 CACCACATCTGGCTAATATTTGG + Intergenic
910841294 1:91564420-91564442 CACAACGTGTGGGCCTTATTTGG + Intergenic
914351780 1:146846088-146846110 CACAACATGTGGGGATTATAGGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921273227 1:213491141-213491163 AACAAAATGTGTCTGTTATCTGG + Intergenic
923102438 1:230827119-230827141 CACAGAATGTGGCTGTTTTCTGG + Intergenic
1063151852 10:3344321-3344343 CAGCACATGTGGCTGTTACCCGG + Intergenic
1063643224 10:7852357-7852379 CACAACGTGTGGATGTTATTTGG - Intronic
1064287710 10:14006379-14006401 CACAAAACATGTCTGTTATTGGG - Intronic
1066249534 10:33619263-33619285 CTCAACATGTGGGGGTTATGGGG - Intergenic
1066534772 10:36380058-36380080 CAGGTCATGTGGCTGATATTGGG + Intergenic
1068896584 10:62210135-62210157 CATAATATGTGGCCCTTATTTGG + Intronic
1071761594 10:88614048-88614070 GGCAACATGTGACTCTTATTTGG + Intergenic
1074152841 10:110773287-110773309 CACCACATGTGGATGTCACTGGG + Intronic
1078709989 11:13782258-13782280 TACATCATGGGGCTGTTATGAGG - Intergenic
1079157840 11:17965103-17965125 CACAACATGTGGGGATTATGGGG - Intronic
1079799813 11:24854712-24854734 CACAAAATGGGGCAGTTGTTTGG - Intronic
1079976732 11:27100908-27100930 CAGGACAGGTGGCTGTTATTGGG + Intronic
1082131384 11:48493746-48493768 TATAACATGTGTTTGTTATTAGG + Intergenic
1082564878 11:54664623-54664645 TATAACATGTGTTTGTTATTAGG + Intergenic
1087771200 11:102212332-102212354 CATATCATGTGGCTGTTGTAGGG + Intronic
1087970489 11:104475237-104475259 CACAACATGTGGCATTTTTTGGG - Intergenic
1088393780 11:109345004-109345026 CACAACATGTGGGGATTATGAGG - Intergenic
1090047102 11:123345515-123345537 CAGAACATTTGGCTATTACTAGG - Intergenic
1091039829 11:132266517-132266539 CATTACATGTGGCTTCTATTTGG - Intronic
1092277845 12:7075664-7075686 CACCACATCTGGCTCTTCTTTGG + Intergenic
1093118560 12:15240816-15240838 TAGAACATGATGCTGTTATTTGG + Intronic
1093482266 12:19616822-19616844 CACAATATGTGGCTACTATGTGG + Intronic
1096172192 12:49480693-49480715 ACCAACATGTGGTTTTTATTGGG + Intronic
1098491201 12:71081468-71081490 GACTACATGTGCCAGTTATTAGG + Intronic
1099468666 12:83019342-83019364 CAGAAGAAGTGGGTGTTATTTGG - Intronic
1100173462 12:92003686-92003708 CACAACGTTTGCCTGTTAATGGG - Intronic
1101020626 12:100549728-100549750 CACAATATATGGTTGATATTTGG - Intronic
1101604397 12:106237081-106237103 AACAGCATGTGGTTTTTATTGGG + Intergenic
1102667187 12:114585023-114585045 AACAACATCTGACTTTTATTTGG + Intergenic
1103686491 12:122736153-122736175 CACATCATGTGGGAGTTATGGGG - Intergenic
1104135115 12:125930593-125930615 CACAACATGTGGGAATTATGAGG - Intergenic
1105013115 12:132769031-132769053 CTCAAGTTGTGGCTGTTCTTGGG - Exonic
1106535144 13:30633824-30633846 CTCAACATGTTGCTGTCAGTTGG + Intronic
1107199295 13:37694812-37694834 CCCCAAATGTGGATGTTATTTGG + Intronic
1107714485 13:43186745-43186767 CAAAACCTCTGGGTGTTATTAGG + Intergenic
1108587764 13:51885539-51885561 CACAACATGTGGGGATTATCAGG + Intergenic
1110987611 13:81990947-81990969 CACAACAAGTGTCTGCTAGTTGG + Intergenic
1111107574 13:83667724-83667746 CACAACATGTGGGGATTATGTGG - Intergenic
1113855303 13:113441222-113441244 GACAACTTCTGACTGTTATTGGG + Intronic
1118823590 14:69361075-69361097 AACCATATGTGGCTGGTATTGGG - Intergenic
1119854462 14:77888930-77888952 CACAACATGTGGGGCTTATGGGG - Intronic
1120554488 14:85912424-85912446 CACAACTTTTGGGTGTTTTTCGG - Intergenic
1121937326 14:98031987-98032009 CACAACATGTGGGAATTATGGGG - Intergenic
1127223231 15:56902278-56902300 TACAACATGTGGACTTTATTTGG + Intronic
1127574490 15:60277385-60277407 CACAGCATGATGCTGATATTTGG - Intergenic
1129133901 15:73528944-73528966 CACAATATGTGGACCTTATTTGG + Intronic
1131383085 15:91980655-91980677 CACACCATGCAGCTATTATTGGG + Intronic
1133913148 16:10084230-10084252 CACAACATTTGGTTCTTAGTAGG - Intronic
1135136635 16:19889673-19889695 CACCACATGTGGCTGGGACTGGG + Intergenic
1136014798 16:27389431-27389453 CGCAACATGTGGCTGAAACTGGG - Intergenic
1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG + Intergenic
1140281419 16:73558403-73558425 CACCACATGGTGCTGGTATTTGG - Intergenic
1140293799 16:73688736-73688758 CACAACATGTGGGAATTATGGGG - Intergenic
1140741299 16:77943813-77943835 CATAGCATGTGGCAGTTATTAGG + Intronic
1146191260 17:30768957-30768979 TTCACCATGTGGCTGTTACTAGG - Intergenic
1153274042 18:3350776-3350798 CACATTTTGTGGTTGTTATTTGG - Intergenic
1154145336 18:11861987-11862009 CACAACATCTGGATTTGATTAGG + Intronic
1155400458 18:25433192-25433214 CGCAATATGTGGCCCTTATTTGG + Intergenic
1156324007 18:36056773-36056795 CATAACTTGTGGCTGTTCTAAGG - Intronic
1158414517 18:57237739-57237761 CACAACATGTGGGGATTATATGG + Intergenic
1164840731 19:31390347-31390369 CAGAACATTTGGCTGTTAGAGGG + Intergenic
927635628 2:24814047-24814069 CACAACAGGTGGCTGTGAAGAGG - Intronic
927756264 2:25710589-25710611 CACAACACTTGGCTGTTTTGTGG - Intergenic
928134930 2:28681024-28681046 CATAACATTTGCCTGTGATTAGG - Intergenic
929439807 2:41956475-41956497 CACACCATGTGGCTGCTCTGAGG - Intergenic
930903405 2:56535306-56535328 AACAACATGTGCCTTTTAATAGG - Intergenic
931951894 2:67373358-67373380 CACAACATCTGGCTAGTCTTGGG - Intergenic
933031786 2:77337456-77337478 CTCAACATGTGGAGATTATTGGG - Intronic
933469858 2:82708113-82708135 CAAAACATGTGGATTTTCTTTGG + Intergenic
934302408 2:91786131-91786153 CACAACATGATGCTGTAACTGGG + Intergenic
935185656 2:100730523-100730545 TTCAACATGTGGCTGTTCTTTGG - Intergenic
936062205 2:109302458-109302480 CACAACATGTGCCTCCTCTTAGG + Intronic
938245337 2:129772363-129772385 AACATCATGTGGCTATTATTAGG - Intergenic
939025579 2:137009752-137009774 CACAACATGTGGGAATTATCCGG + Intronic
941297789 2:163761741-163761763 CTCAAAATGTGGCTGAAATTTGG - Intergenic
941326153 2:164117053-164117075 CACTACCTGTGGCTGGTATCAGG - Intergenic
941618137 2:167746460-167746482 CACAACATGATGCTGATCTTTGG - Intergenic
942400430 2:175595893-175595915 CACATCATGTGATTGATATTAGG + Intergenic
944101081 2:196028618-196028640 CACAAAATGTGGCTCATATTTGG - Intronic
946127934 2:217580740-217580762 CACAACATGTGGGGATTATGGGG + Intronic
946577116 2:221087538-221087560 CACAACATGTGGAAATTATAGGG + Intergenic
947572505 2:231247327-231247349 CAGGACATGTGGCTCTTATAAGG + Intronic
949057294 2:241935014-241935036 CACAAGATGTTGGTGTTACTGGG + Intergenic
1169218525 20:3807213-3807235 CACAATAGGTGGGAGTTATTGGG + Intergenic
1170087407 20:12549799-12549821 TACAACATGTTATTGTTATTTGG + Intergenic
1178291232 21:31370209-31370231 CACAATGTATGGGTGTTATTTGG + Intronic
1178554074 21:33571254-33571276 CACAACATGTAGAAGTCATTAGG + Intronic
1183561685 22:38579884-38579906 TACAACATGTGGACATTATTTGG - Intronic
1183631093 22:39033061-39033083 CACCACATCTGGCTTTTTTTTGG - Exonic
951949979 3:28189277-28189299 CACATCATGTGGCGTTTGTTCGG - Intergenic
952475848 3:33709816-33709838 CACAACATGTGGCTGTTATTTGG + Intronic
952629668 3:35451510-35451532 AACAACAAGTGGCTCATATTCGG + Intergenic
953398914 3:42595220-42595242 TACAACATGTGAATCTTATTTGG - Intronic
956854515 3:73262858-73262880 CACAGCATCTGGCTCATATTAGG - Intergenic
961168934 3:124782171-124782193 CACAACATAGGGTTATTATTGGG - Intronic
961543194 3:127614412-127614434 CACAACTTATGGATCTTATTTGG - Intronic
962848975 3:139293808-139293830 CACAACATGGGGTTGTTATCAGG + Intronic
964832370 3:160898573-160898595 CCCAACATGTGCCTGTGGTTTGG - Intronic
964895687 3:161591874-161591896 CACAACATGTGGAAATTATGAGG + Intergenic
964913310 3:161809005-161809027 CACAACATAAGGCTGTTTTGAGG - Intergenic
964923540 3:161927255-161927277 CACAACATGTGGGGATTATGGGG - Intergenic
965799517 3:172477203-172477225 CCCAACTTGTAGCGGTTATTAGG - Intergenic
969092439 4:4705036-4705058 CTCTCCATGTGGCTTTTATTAGG - Intergenic
970823733 4:20250801-20250823 TACAATATGAGGCTGGTATTAGG + Intergenic
973128138 4:46614468-46614490 CACAACATGTGGGAATTATGCGG + Intergenic
974773714 4:66451283-66451305 TGCAACATGTAGCTGTGATTTGG + Intergenic
974788173 4:66649782-66649804 AATAACATGTGACTGTTAGTGGG - Intergenic
974894670 4:67924811-67924833 CACAACATGTGGGAATTATGGGG + Intronic
975129556 4:70819042-70819064 TACAAAATGTGGCCATTATTGGG - Exonic
976470890 4:85427629-85427651 CAAGAAATGTGGCTTTTATTTGG - Intergenic
977082469 4:92549038-92549060 CAAAACATGTTACTCTTATTTGG + Intronic
979177250 4:117679906-117679928 CACAACATGTGGGAATTATGGGG - Intergenic
979645055 4:123058738-123058760 CACAACATGTGGGAATTATGGGG + Intronic
980266746 4:130525555-130525577 CACAACATGTGGGAATTATGGGG + Intergenic
980832134 4:138143804-138143826 CAGAACATGTGACTACTATTTGG - Intergenic
981496953 4:145404527-145404549 CACAATATCTGGCTCTTAATAGG + Intergenic
982586216 4:157243749-157243771 CACAATATTTGGCTGTAAGTTGG + Intronic
984632241 4:182073324-182073346 CACAACATGTGGGGATTATGGGG + Intergenic
984831445 4:183978812-183978834 CACAACATGAAGCAGTTCTTTGG + Intronic
987248285 5:16072645-16072667 CACAACTTGTGGCAGATATTTGG - Intronic
988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG + Intergenic
988516282 5:31907557-31907579 CACTACATGTAGCTATTAGTGGG - Intronic
993739933 5:91525970-91525992 AACACCATGGGGCTGTAATTAGG - Intergenic
994548577 5:101203863-101203885 CACAACATGTGGGAATTATGGGG - Intergenic
996175796 5:120355094-120355116 CAAAACATATGTCTTTTATTCGG + Intergenic
996973590 5:129403007-129403029 CAAAATTTGTGGCTGATATTTGG - Intergenic
997242107 5:132315203-132315225 CCCAACATGTGGCTCTGCTTGGG + Intronic
997610617 5:135213250-135213272 CTCCACATGTGGCTATTGTTAGG - Intronic
999026426 5:148237023-148237045 CACAACATGTGGGAATTATGAGG + Intergenic
1000433400 5:161179262-161179284 CATAGCATGTGGCTGTTCCTGGG - Intergenic
1004560163 6:16742291-16742313 CCCAAGTTGTGGCTTTTATTGGG - Intronic
1008931287 6:56943099-56943121 CACAGCATTTGGCTCTCATTTGG + Intronic
1009546172 6:65022004-65022026 CACAACATGTGGGAATTATGAGG + Intronic
1010534990 6:77015268-77015290 CACAGCATGTGGCTTTTCTCTGG + Intergenic
1011439324 6:87370479-87370501 CACAACATGTGGGAATTAATGGG + Intronic
1011562484 6:88635306-88635328 GAAAACATGTAGCTGTTATTTGG + Intronic
1011598466 6:89038410-89038432 CACAACATGTGGGGATTATGGGG + Intergenic
1011948000 6:92931372-92931394 CCCCAAATGTGACTGTTATTTGG - Intergenic
1013309466 6:108879735-108879757 CATAACAACTGGCTGTTCTTGGG - Intronic
1015592858 6:134839068-134839090 CACAACATGTGGGGATTATGGGG + Intergenic
1018626230 6:165781451-165781473 CACCACATGTGGCAGTTAGTTGG - Intronic
1018962964 6:168461294-168461316 CACAACATGTGGGAATTATGGGG + Intronic
1020407552 7:7854609-7854631 CACAACACTTGGATGTTATGGGG + Intronic
1020737859 7:11973883-11973905 CACAACATGTGGGGATTATGGGG + Intergenic
1023487637 7:40703831-40703853 GACCACATGTTGCTATTATTTGG - Intronic
1023772016 7:43566459-43566481 CAAACCATGTGGCTCTTACTGGG + Intergenic
1025264111 7:57441193-57441215 CACAAGGTGTGGCTGGTAGTTGG - Intergenic
1026607836 7:71830801-71830823 TACAACATGTGGTTGTTATGTGG + Intronic
1027000568 7:74650640-74650662 CGCAACATGTTGCTGTCAATGGG - Intergenic
1027025519 7:74849249-74849271 CGCAACATGTTGCTGTCAATGGG + Intronic
1027062245 7:75094870-75094892 CGCAACATGTTGCTGTCAATGGG - Intronic
1028704033 7:93816925-93816947 CATAGCATGTGACTGTCATTAGG - Intronic
1031170701 7:118289489-118289511 CACAACATGTGGGGATTATGGGG - Intergenic
1032432247 7:131871608-131871630 CACAACATGTGGGAATTATGGGG + Intergenic
1033922627 7:146412998-146413020 CACAAAATGTGGCTGATTGTCGG + Intronic
1034751696 7:153574987-153575009 CACAATATGTGGGAGTTATGAGG - Intergenic
1035185891 7:157125625-157125647 CACAACATGTTGGCCTTATTGGG + Intergenic
1035925104 8:3719706-3719728 CATAATATGTGGCTGGTATGGGG - Intronic
1036486312 8:9182612-9182634 CTCATCATGTGGCAGTAATTGGG - Intergenic
1037160713 8:15768790-15768812 CTCATGATTTGGCTGTTATTGGG - Intergenic
1037280275 8:17233525-17233547 CTCATCATGTGGTTGTTACTGGG - Intronic
1038490075 8:27964612-27964634 ACCAACAGGTGGATGTTATTAGG - Intronic
1038564756 8:28610457-28610479 CACTACCTGTGGTTGTCATTTGG + Intronic
1041049965 8:53924747-53924769 CATAACATCTGGCTCTTAGTAGG - Intronic
1041391147 8:57348676-57348698 CACAGCATGGGGCTGTGACTGGG + Intergenic
1042029839 8:64464037-64464059 CACAACATGTGGGGATTATGGGG - Intergenic
1042895930 8:73667727-73667749 CACAACATGTGGCAATGAGTAGG + Intronic
1043641887 8:82463862-82463884 CAAAATAAATGGCTGTTATTAGG - Intergenic
1043653405 8:82629511-82629533 GACATCTTGTGGCAGTTATTTGG + Intergenic
1045566716 8:103324285-103324307 AAAAACTTGTGGCTGTTAATGGG - Intronic
1046414192 8:113889982-113890004 CCCAAGATGTTGCTGTTCTTTGG + Intergenic
1051108921 9:13612639-13612661 CTCAACATTTGGCTGTCCTTGGG - Intergenic
1052158636 9:25226916-25226938 CCCAACATGTGGCTGAGATGGGG + Intergenic
1054717493 9:68570853-68570875 CACAACATGTGGGAATTAATGGG + Intergenic
1055022035 9:71680370-71680392 CAGAGTATGTGGCTGTTACTGGG - Intergenic
1055472371 9:76625475-76625497 CAGAACATGTCTCTGTCATTAGG + Intronic
1057450655 9:95155870-95155892 CACCACATCTGGCTTTTTTTGGG + Intronic
1058028098 9:100164800-100164822 CACAATATATAGCTCTTATTTGG - Intronic
1058196618 9:101984720-101984742 CAGAACATGTGACTGTTGTTAGG - Intergenic
1058302396 9:103392338-103392360 CACAACATGTGGGGATTATGGGG - Intergenic
1058392081 9:104507007-104507029 CACAGCATGATGCTGTTATTTGG + Intergenic
1059787270 9:117599098-117599120 AACAAGGTGTGGCTGTGATTTGG - Intergenic
1060211395 9:121712645-121712667 CCCAACATGTGGTTGACATTGGG + Intronic
1062166639 9:135111095-135111117 CACCACATGTGGCTGAAATGCGG + Intronic
1185604779 X:1361902-1361924 CACAACACGTGGGAGTTATAAGG + Intronic
1187931518 X:24297540-24297562 CACAACATGTGGGGATTATGGGG + Intergenic
1189877808 X:45455028-45455050 CACAACATGTGGGGATTATGGGG - Intergenic
1190648133 X:52542461-52542483 CAGGCCATGTGGCTGATATTTGG + Intergenic
1194474848 X:94346134-94346156 CACAACATGTGGTGATTATGGGG + Intergenic
1195375867 X:104227747-104227769 CACAACATGTGGGAATTATGGGG - Intergenic
1195849982 X:109272396-109272418 CACAACAAGTAGTTGTTTTTTGG + Intergenic
1198020429 X:132651884-132651906 CACACCAAGGGGCTGTTTTTAGG + Intronic
1198269426 X:135041316-135041338 CACAACATGTGGGGATTATGGGG - Intergenic
1198707065 X:139461185-139461207 CACAACATGTGGGAATTATGGGG - Intergenic