ID: 952478058

View in Genome Browser
Species Human (GRCh38)
Location 3:33731574-33731596
Sequence GTGCAGGTGTAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952478058_952478065 20 Left 952478058 3:33731574-33731596 CCCTGCACCATCTACACCTGCAC 0: 1
1: 0
2: 0
3: 24
4: 256
Right 952478065 3:33731617-33731639 CCACTGCATTGTTCATGCTAAGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952478058 Original CRISPR GTGCAGGTGTAGATGGTGCA GGG (reversed) Intergenic
900187872 1:1340951-1340973 GTGCAGGTGTGTAGTGTGCAGGG - Intronic
900187879 1:1341014-1341036 GTGCAGGGGTGCATTGTGCAGGG - Intronic
900588444 1:3445359-3445381 GTGCCGTTGTAGATGCTTCAGGG + Intergenic
900618591 1:3576758-3576780 GTGCAGGGGTGGAATGTGCAGGG - Intronic
900618624 1:3576887-3576909 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618632 1:3576916-3576938 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618647 1:3576987-3577009 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618655 1:3577016-3577038 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
901681969 1:10918338-10918360 GTGGAGGTTTAGCTGGGGCAGGG - Intergenic
901839450 1:11944803-11944825 GGGCAGGGGTAGCTGGGGCAGGG - Intronic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
904290341 1:29481259-29481281 GTGCTGGTGTGGGTGGGGCATGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905765149 1:40594382-40594404 GCTCAGGTGTACATGGTGCCTGG - Intergenic
906291620 1:44623146-44623168 ATGCAGGTCAAGATAGTGCAGGG + Intronic
906338758 1:44959136-44959158 GTGCAATCGTAGATGGTTCAAGG - Intronic
908444577 1:64188932-64188954 GAGGAGGTGCAGATAGTGCATGG + Intergenic
909349225 1:74629974-74629996 GTGAAGGTGTAGTGAGTGCATGG + Intronic
910096501 1:83528497-83528519 GTGCAGGGGTAAATGGCGAAGGG - Intergenic
913675509 1:121136949-121136971 GTGGTGGTGTAGATGGTGTCTGG + Intergenic
914027405 1:143924889-143924911 GTGGTGGTGTAGATGGTGTCTGG + Intergenic
919416798 1:197320564-197320586 GTACAGGAGTAGATGGTGGTAGG + Intronic
920422787 1:205846700-205846722 GTGCAGGTGTAGATGTTCCTAGG + Intronic
920423669 1:205855035-205855057 ATGCAGGTGTAGATGTTCCCAGG - Intergenic
920462876 1:206155786-206155808 GTGGTGGTGTAGATGGTGTCTGG + Intergenic
921324653 1:213978858-213978880 GGGCAGGTGTTGATGGTAAAAGG + Intergenic
921490238 1:215766758-215766780 GTGAAGCTGTAGTTGGTGTATGG + Exonic
922918223 1:229276293-229276315 GTGCAGGTGCTGTTGGTCCAGGG + Intronic
922997888 1:229981389-229981411 ATGTTGGTGTACATGGTGCAGGG - Intergenic
923688261 1:236169244-236169266 GTGCAGGTGCAGCTGTGGCAGGG + Intronic
924904732 1:248440273-248440295 GTGCAGATCTATATGATGCAGGG + Intergenic
924923155 1:248651775-248651797 GTGCAGATCTATATGATGCAGGG - Intergenic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063275989 10:4568481-4568503 GTGCAGGTGTACTAGGAGCATGG - Intergenic
1064168440 10:13006713-13006735 GTGCATGTGGCAATGGTGCAGGG + Intronic
1064477846 10:15710560-15710582 ATGCAGGAGGACATGGTGCAGGG + Intronic
1065761368 10:28986304-28986326 TGGCAGGTGGAGATGGTGAACGG - Intergenic
1065916605 10:30358567-30358589 GTGCAGGTGTGGGTGTGGCAAGG - Intronic
1065952587 10:30665488-30665510 GGACAGGTATAGATGGGGCATGG + Intergenic
1065952596 10:30665526-30665548 GGACAGGTATAGATGGGGCATGG + Intergenic
1066532754 10:36358322-36358344 TTGCAGGTAAAGATGGTGCCAGG + Intergenic
1067337821 10:45378973-45378995 CTGCAGGTGTAGGTAGGGCAGGG + Intronic
1068900822 10:62268228-62268250 TTGCAGGTGTAGGTGATGCCGGG - Intronic
1069346199 10:67472870-67472892 TTGAAGGTGGAGATGTTGCAAGG - Intronic
1069735443 10:70650930-70650952 GAGCAGGTGCAGATAATGCATGG + Intergenic
1073142341 10:101256458-101256480 GAGCTGGTGGAGATGCTGCAGGG + Intergenic
1076286238 10:129299868-129299890 GTGCAGGAGTAAATTGTTCAGGG - Intergenic
1076823262 10:132952599-132952621 GTGCAGGTGCAGGTACTGCAGGG + Intergenic
1077062674 11:624787-624809 GGGCAGGGGTAGGTGGGGCACGG - Intronic
1077297421 11:1832630-1832652 GTGCAGGTGCAGCGGGCGCATGG - Intronic
1077448677 11:2619889-2619911 GTACAGGTCTATATGTTGCATGG + Intronic
1077675849 11:4192410-4192432 GTGCTGGTGTCCAGGGTGCAAGG + Intergenic
1078428322 11:11268878-11268900 GTCCAGGTGCAGATGGGCCATGG + Intergenic
1089294398 11:117459161-117459183 GTCAAGGTGAAGTTGGTGCAAGG - Intronic
1089758601 11:120706423-120706445 GTGCACGTGTGGATGTGGCATGG + Intronic
1090464830 11:126924780-126924802 GTGAGGGTGTTGATGGGGCAGGG - Intronic
1093006857 12:14060667-14060689 GTGCTAGTGTAGATGGAGAAAGG + Intergenic
1095414808 12:41965217-41965239 GTGCAGTGGTAGAAGGAGCAGGG - Intergenic
1096111191 12:49030357-49030379 GTGCAGCAGAAGATGGTGAATGG - Exonic
1096775217 12:53959615-53959637 GTGGAGGTGCAGAGGGTTCATGG - Intergenic
1097586089 12:61517975-61517997 GTGCAGGTGTGGAAGAGGCACGG - Intergenic
1100392749 12:94158359-94158381 GTGCAGGTCCAGATGGTGAAGGG + Intronic
1101462084 12:104906369-104906391 TTGGAGGTGTAGATGGAGCTTGG + Intronic
1102146987 12:110661528-110661550 CTGCAGGTGAAGATGGTCCCGGG + Intronic
1102599117 12:114015701-114015723 GTGCAGGTGGAGATAGCCCAAGG - Intergenic
1104972167 12:132535985-132536007 GTGCACGTGTACATGATGCGTGG + Intronic
1105278051 13:18947642-18947664 GTACAGGTGTAGATGCAGCTGGG - Intergenic
1105278064 13:18947718-18947740 GTGCAGGTGTAGATGCAGCTGGG - Intergenic
1106480709 13:30135156-30135178 GCGCTGGTGTGGGTGGTGCAGGG + Intergenic
1107769313 13:43773077-43773099 GTGCAGGAATAGATGGTGGTGGG - Intronic
1112158607 13:96845576-96845598 GTGCAGGTACAGATGGTTGAGGG - Intergenic
1112963723 13:105161076-105161098 GTGCAGATGTTGATGCTCCACGG - Intergenic
1115376903 14:32686313-32686335 GGGGAGGTGTAGATGGTTAATGG + Intronic
1118436778 14:65778531-65778553 GGGCAGGGGTAGATGAGGCAAGG - Intergenic
1119673001 14:76533824-76533846 ATGCTGATGTAGCTGGTGCAGGG - Intergenic
1121507475 14:94487686-94487708 GTGAAGGAAAAGATGGTGCAGGG + Intronic
1123009452 14:105340752-105340774 GTGCAGGTGTCCATGGTCCAGGG + Intronic
1124505465 15:30268953-30268975 GTGCAGGTGCAAATGTTGCTAGG - Intergenic
1124738087 15:32269678-32269700 GTGCAGGTGCAAATGTTGCTAGG + Intergenic
1127064507 15:55222772-55222794 GAGATGGTGTAGATGGTGTAGGG - Intronic
1127540273 15:59930837-59930859 GTGAAGATGGAGAAGGTGCAGGG - Intergenic
1127605574 15:60583980-60584002 GTGCAGGTGTTGCTGGAGAAAGG + Intronic
1129740826 15:77988813-77988835 GTGCAGGGGTGGGTGTTGCAGGG - Intronic
1129844898 15:78763727-78763749 GTGCAGGGGTGGGTGTTGCAGGG + Exonic
1130256927 15:82330113-82330135 GTGCAGGGGTGGGTGTTGCAGGG - Intergenic
1130459871 15:84152898-84152920 GGGCAGGTGGAGGTGGCGCAGGG - Intergenic
1130598021 15:85259875-85259897 GTGCAGGGGTGGGTGTTGCAGGG + Intergenic
1131107748 15:89746270-89746292 GTGGAGGTGTGGATGCTGCATGG - Intergenic
1132571495 16:646361-646383 GTGCAGGTGGAGATGGGACAGGG - Intronic
1132579171 16:677322-677344 GTGCCCCTGGAGATGGTGCACGG + Exonic
1132977501 16:2717878-2717900 GAGGAGGTGGAGAAGGTGCAGGG + Intronic
1133253994 16:4505098-4505120 GTGCATGTGCATATGCTGCAGGG - Intronic
1134869081 16:17635301-17635323 GTGCTGGTGAGGATGTTGCAAGG + Intergenic
1135052563 16:19204510-19204532 GAGCAGGTGAGGATGGGGCAGGG + Intronic
1136233285 16:28900343-28900365 CTGCAGGTGCTGATGGTGCCAGG - Intronic
1136356193 16:29745974-29745996 GTGCAGGCTTGGAGGGTGCAGGG + Exonic
1136419500 16:30123112-30123134 GGGGAGGTGGAGATGGTGAAGGG - Exonic
1138410295 16:56834019-56834041 CTGCAGGAGTAGATGCTGCTGGG + Intronic
1140197448 16:72866830-72866852 GTGCCTGTGTGGATGGTGAATGG - Intronic
1140619858 16:76716824-76716846 GTTCTGGTGGAGATGGTGGAGGG - Intergenic
1141206067 16:81933987-81934009 GTGCAGGTTTTGAGGGTGCAGGG + Intronic
1141611384 16:85182910-85182932 GTGCAGGAGAAGGAGGTGCAAGG - Intronic
1141869271 16:86773479-86773501 GTGCTGGTGTACATGGAGCCAGG + Intergenic
1142143196 16:88481664-88481686 GTGCAGGGGGACAGGGTGCATGG - Intronic
1142597127 17:1035352-1035374 GAGCAGGTGTAGGGGGTGGAAGG - Intronic
1146376463 17:32298138-32298160 GTGCCCCTGGAGATGGTGCATGG + Exonic
1149373211 17:56017356-56017378 ATGCAGGAGTAGATGATGCCAGG - Intergenic
1151712391 17:75814125-75814147 GGGCAGGTGTAGATGGAGTGTGG + Intronic
1153716369 18:7853364-7853386 TTGCAGGTGGAGTTGGTGCTAGG + Intronic
1156646715 18:39171663-39171685 GTGAAGGAGTAGAAGGTGGAGGG + Intergenic
1157162869 18:45330451-45330473 GTGTAAGTGATGATGGTGCATGG + Intronic
1158931881 18:62330743-62330765 GTGCAGGGGCAGAAGGTGCAGGG + Intronic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163609963 19:18295587-18295609 GTGGATGGGTAGATGGTGGATGG - Intergenic
1164849841 19:31472277-31472299 GTGCAGGTGGTGCTGGTGAATGG + Intergenic
1165077311 19:33287001-33287023 TTGCGGGTGCAGATGGGGCATGG + Intergenic
1166997618 19:46727315-46727337 GTGCAGATGTAGACAGTGGAGGG - Intronic
1167281480 19:48571779-48571801 GAGCAGGGGAAGAGGGTGCAGGG + Intronic
1168093768 19:54102893-54102915 GTGCAGGTGCCGGTGGCGCACGG + Intronic
925142958 2:1562539-1562561 GTGCCGCTGAAGATGGTCCAGGG - Intergenic
925178164 2:1799309-1799331 GTGCAGGTGCAGAGCGTGCCTGG + Intronic
929003546 2:37372007-37372029 GTGCAGGTGTAGATGCTTATAGG - Intronic
932246957 2:70204127-70204149 GAGGAGGTGCAGATAGTGCATGG + Intronic
932559011 2:72851050-72851072 GTGCAGCTGTGGATGGAGCTTGG - Intergenic
935355671 2:102197282-102197304 TTGCAGGTGAAGATGCTGGAAGG + Intronic
935690879 2:105731408-105731430 GAGCAGGTGTAGCTGGTGCCTGG - Intergenic
937144153 2:119627958-119627980 GTGCAGGTGTATCAGGAGCAAGG - Intronic
937542529 2:122976047-122976069 GCCCAGGTGTATATGGAGCAAGG + Intergenic
937750191 2:125467483-125467505 GTGCATTTGTAGATGGGCCATGG + Intergenic
938189055 2:129257872-129257894 GTGTGGGTGTAAATTGTGCACGG - Intergenic
938921178 2:135996508-135996530 GAGCAGGTGAACGTGGTGCAAGG - Intergenic
938937049 2:136136292-136136314 CCGCAGGTGTAGATGCTGCCGGG - Intergenic
939086656 2:137727459-137727481 ATGCAGGTGTAGATCGTTCAAGG - Intergenic
942389229 2:175475161-175475183 CTGCAGGTGCAGATGGTTCCAGG + Intergenic
944581665 2:201137485-201137507 GTGCAGGGCGAGATGGTGGAGGG - Intronic
947094617 2:226551691-226551713 GTCCAGGTGTAGATAGGGCTAGG + Intergenic
947924642 2:233910726-233910748 GTGGAGGTGTAGATGGAGTTAGG - Intergenic
1169714695 20:8601952-8601974 GTGAAGGTGTTGGTGCTGCAAGG - Intronic
1170557315 20:17525269-17525291 ATGGTGGTGTAGATTGTGCAGGG - Intronic
1170713743 20:18814683-18814705 GTGCAGGTGTGCATTCTGCATGG + Intronic
1170824734 20:19783769-19783791 GTGGAGGTGTGGGAGGTGCAGGG + Intergenic
1171193629 20:23179985-23180007 CTGCAGGTGAGGATGGTGCTGGG - Intergenic
1172223884 20:33291387-33291409 GGGCAGGTGTAGGTGGAGCCAGG + Intronic
1174342319 20:49905764-49905786 GTGCAGGTGTTGGTGGCGCCTGG + Exonic
1174554446 20:51383745-51383767 GTGCATGTGTGGGTGGGGCATGG + Intergenic
1174938024 20:54893563-54893585 GTGCAGGTGGTGGTGGTGCTAGG + Intergenic
1175204773 20:57303108-57303130 CTGCAGGTGCAGATGTTCCAAGG - Intergenic
1175935071 20:62510474-62510496 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175935098 20:62510550-62510572 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1176076932 20:63252934-63252956 GTGCTGGGGTTGATGGTGCTGGG - Intronic
1178065173 21:28896633-28896655 GTGCAGGTCTAGAGGGTGCTGGG - Intergenic
1178507697 21:33176462-33176484 GGACAGGGGTAGATGGTGTAGGG - Intergenic
1179659630 21:42865960-42865982 GTGTGGGTGTGGATGGTGCCTGG - Intronic
1179943521 21:44654867-44654889 GAGCAGGGGTAGCTGGTGAAGGG + Intronic
1180593965 22:16961839-16961861 GTGCAGATGGAGATGGCTCAGGG - Intergenic
1180998000 22:19975027-19975049 GGGCAGGAGTAGAGGGAGCATGG - Intronic
1181489440 22:23252344-23252366 GGGCAGGTGTGCAAGGTGCAAGG + Intronic
1182973521 22:34600013-34600035 GTGCAGGTGAGGATGGAGCTGGG - Intergenic
1184034316 22:41911248-41911270 GTCCAGGTGCAGATGGGGGACGG - Exonic
1185066567 22:48635261-48635283 GGGCAGGCGTAGCTGGTGGAGGG + Intronic
950553641 3:13682423-13682445 GTGAGGGTGTAGAGGGAGCAGGG + Intergenic
952478058 3:33731574-33731596 GTGCAGGTGTAGATGGTGCAGGG - Intergenic
953412588 3:42698675-42698697 GTGCAGGGGTAGAGGGTGTAGGG - Intronic
953672737 3:44976305-44976327 GAGAAGGTGTACATCGTGCATGG + Exonic
953862721 3:46558722-46558744 GTGCAGTTGTAGGAAGTGCACGG - Intronic
954854981 3:53636087-53636109 GTGGATGTGTATATGGTGGAGGG + Intronic
955089270 3:55733143-55733165 GTGCAGGAGAGGAGGGTGCAGGG + Intronic
955980800 3:64525362-64525384 GTGCAGGCGCAGAGGGTGGAGGG - Intronic
957348113 3:78987625-78987647 GGGGAGGTGGAGATGGTGAATGG + Intronic
961426651 3:126853629-126853651 AAGCAGGTGTTGATGGGGCAAGG - Intronic
961522566 3:127475511-127475533 GTGCAGCTGCAGATGGGGCTGGG - Intergenic
961833354 3:129636681-129636703 GGGCAGGTATAGATGAAGCAGGG + Intergenic
962257766 3:133884146-133884168 TTGCCAGTGTAGCTGGTGCATGG - Intronic
962655668 3:137542127-137542149 GTGCACGTGTGGATGCTGGAGGG - Intergenic
963922926 3:150923441-150923463 GAGCAAGTGGAGACGGTGCAAGG + Intronic
964967718 3:162518346-162518368 GTGGAGGGGTAGACGCTGCATGG - Intergenic
965901313 3:173644872-173644894 GGGCAGGTGTTGAGGGGGCATGG + Intronic
968962233 4:3751498-3751520 GGACAGGGCTAGATGGTGCATGG - Intergenic
969078373 4:4598877-4598899 GGGCAGGTGCAGATGGTGAGCGG + Intergenic
969402056 4:6962199-6962221 GTGCAGGTATGGATGGTGGCGGG + Intronic
969535608 4:7754746-7754768 GGGCAGGTGTGGAGGGTGGAAGG + Intergenic
969613041 4:8237623-8237645 GTGAAGGTGTACCTGGTGCTCGG + Exonic
970503491 4:16702920-16702942 GTACAGGTGAGGAGGGTGCATGG - Intronic
970563612 4:17308911-17308933 GTGCAGCTGGAGAAGGTGCCAGG - Intergenic
975376351 4:73650841-73650863 GTGCAAGTGTATATGTTGGAAGG - Intergenic
977688250 4:99874055-99874077 GTGATGATGTAGATGCTGCAAGG - Intergenic
979389584 4:120112326-120112348 GTGCATGTGTGGAAGGTGAAGGG + Intergenic
982572377 4:157066452-157066474 GTGCAGTTGCACATGGTACAAGG + Intergenic
983520311 4:168701726-168701748 TTCCAGGTGTAGATGATTCAAGG + Intronic
983702268 4:170612316-170612338 GTGGAGGGGTAGAGGGTGAAGGG + Intergenic
984316656 4:178138769-178138791 GTGAAGGTGCAGATAGTGCGTGG + Intergenic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
989466504 5:41762184-41762206 TTGCAGGGGAAGATGGTGAAAGG - Exonic
991977023 5:72193580-72193602 GGGCAGGAATAGATGGTGGAGGG + Intronic
995295165 5:110511933-110511955 GTGCAGGTTCCTATGGTGCAAGG - Intronic
997203377 5:132026395-132026417 GTGCAGATGCAGAGGGTTCAGGG + Intergenic
998251711 5:140557811-140557833 GTGAATGTGGAGATTGTGCAGGG - Exonic
999190318 5:149742286-149742308 GTGCAGGTGCAGATGGGAGAGGG - Intronic
1000325175 5:160166639-160166661 GAGCAGGTGGAGACGGGGCAGGG - Intergenic
1003840596 6:10115217-10115239 GTGGAGGGGTAGATAGTGAAGGG - Intronic
1005430912 6:25756016-25756038 GTACAAGTGTTGATGGTGGATGG - Intronic
1005873157 6:29992365-29992387 GTGCAGGTCAAGGTGCTGCAGGG - Intergenic
1006926433 6:37658067-37658089 GCGAAGGTGTAGATGGTAGAGGG + Intronic
1009922403 6:70078650-70078672 GTACAGGTGCAGTTGGTGCCAGG - Intronic
1010092501 6:72001508-72001530 ATTCAGGTGTATATGGGGCAGGG - Intronic
1010922729 6:81704053-81704075 GTGCAGGTGAAGCTGGGGCATGG - Intronic
1011350490 6:86417862-86417884 GGGCAGGGGTAGAGGGTGTATGG - Intergenic
1011744758 6:90398808-90398830 GTGCAGGTGGACATCCTGCAGGG - Intergenic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1016359439 6:143251787-143251809 GTGTAGATGTAGATGGTGGGAGG - Intronic
1016374450 6:143406237-143406259 GGGCAGGATGAGATGGTGCATGG + Intergenic
1016826805 6:148395951-148395973 GTGCAGTTGTTGATGTGGCACGG + Intronic
1018059321 6:160078390-160078412 GTGCAGGTGTACCAGGTGCCAGG + Intronic
1018349070 6:162937366-162937388 GTGCAGGTGTAGAGAGAGAAGGG + Intronic
1018710764 6:166496907-166496929 GTGCAGGTTTTGCCGGTGCAGGG - Intronic
1019480928 7:1266489-1266511 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019480938 7:1266536-1266558 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1020090263 7:5334860-5334882 GTGCCAGGGTAGAGGGTGCAGGG - Intronic
1023757221 7:43431192-43431214 GTGCAGGAATAGATGGCTCATGG - Intronic
1023840918 7:44097041-44097063 GGGAAGGTGGAGAGGGTGCAGGG + Intergenic
1024102646 7:46048553-46048575 GTGTAAGTGCAGGTGGTGCAAGG + Intergenic
1029608776 7:101615486-101615508 GTGCGGGTGGAGGTGGTGTAGGG - Intronic
1033646408 7:143308175-143308197 GTGCAGGTGCAGATGGGCCATGG + Intergenic
1033881978 7:145896250-145896272 GTGGAGGTGAAGATGGTTAATGG - Intergenic
1033929868 7:146508135-146508157 GAGGAGGTGCAGATAGTGCATGG - Intronic
1035488904 7:159254910-159254932 GAACAGGTGAAGATGGGGCAGGG + Intergenic
1036192489 8:6683121-6683143 GTTGTGGTGAAGATGGTGCATGG - Intergenic
1036565956 8:9938273-9938295 GGGCAGGTGTAGATGTGACATGG - Intergenic
1036791875 8:11726488-11726510 GTGCAGGTGGAGATGTCCCAGGG + Intronic
1037839937 8:22237495-22237517 GTGCAGGGAGAGATTGTGCAGGG + Intergenic
1038575233 8:28699273-28699295 TTGCAGGTGGAGATGATGCAGGG + Intronic
1039610891 8:38918448-38918470 GTGCATGTGTGTATGGTGTATGG - Intronic
1039708177 8:40028621-40028643 GGGCAGGTGGAGATGGTTAATGG - Intergenic
1040499223 8:47992526-47992548 GTGCAGGAATAGATGGGGAATGG + Intergenic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1041180526 8:55243089-55243111 GTGCAGGGGTAGATGGTATATGG - Intronic
1042200169 8:66274031-66274053 GGGCAGGTGTAGGTGGGGCCAGG - Intergenic
1042704379 8:71650891-71650913 GTGCAGGGGTCAAGGGTGCAGGG - Intergenic
1043331721 8:79124711-79124733 GTGAAGGTGGAGATGGAGAAAGG + Intergenic
1048609790 8:136009848-136009870 CTGCAGGGGTAGGTGGTGCAGGG - Intergenic
1049040782 8:140110673-140110695 GTGCAGGGGGAGCTGCTGCAGGG - Intronic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049731900 8:144182413-144182435 TTGGAGATGTAGATGGTTCAGGG + Intronic
1049771216 8:144382894-144382916 GTGCAGGGGCATCTGGTGCAGGG + Intronic
1051774557 9:20620806-20620828 GTGCAGGTGAAGCTGGAGCTGGG - Exonic
1052454632 9:28680138-28680160 GAGCAGGTGTGGTGGGTGCAGGG - Intergenic
1055411488 9:76034572-76034594 CTCCAAGTGTAGATGGTGGAAGG - Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057274912 9:93671047-93671069 GTGCAGGTGTAGATGCAGGTGGG + Intronic
1057842934 9:98500813-98500835 GTGCTGGTGTTACTGGTGCAGGG - Intronic
1059396415 9:114036701-114036723 GTGCAGGTGGAAATGGAACATGG + Intronic
1060372963 9:123091942-123091964 AGGCAGGTGTACATGGAGCAGGG + Intronic
1061629827 9:131865103-131865125 GCGCAGGTGTTTATGGTACATGG - Intronic
1062656798 9:137607793-137607815 GTCCAAGTGCAGGTGGTGCAAGG + Intronic
1185593142 X:1291748-1291770 GTCCAGGTGGAGGTGGTACAGGG - Intronic
1185593186 X:1291962-1291984 GTCCAGGTGGAGGTGGTGCAGGG - Intronic
1185593210 X:1292087-1292109 GTCCAGGTGGAGGTGGTGCAGGG - Intronic
1185593456 X:1293609-1293631 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593476 X:1293696-1293718 GTCCAGGTGGAGATGGGGCAGGG - Intronic
1185593496 X:1293783-1293805 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593517 X:1293869-1293891 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593546 X:1293999-1294021 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593578 X:1294126-1294148 GTCCAGGTGGAGATGGGGCAGGG - Intronic
1185829117 X:3281948-3281970 GTGCAGTTCTTGCTGGTGCATGG - Intronic
1187369149 X:18689917-18689939 GTGAAGGTGTTGATGGGGGATGG - Intronic
1187766112 X:22644002-22644024 GTGCTGGAGTAGATCGTGCCTGG - Intergenic
1188905187 X:35783180-35783202 GGGCAGGTGGAGATGGTTAATGG - Intergenic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1190715645 X:53100867-53100889 GTGCTGATGTAGAAGCTGCAAGG - Intergenic
1192890046 X:75380753-75380775 GGGCAGGTGTAGTTGGGGGAAGG - Intronic
1193021683 X:76799232-76799254 TTGCAGATCTAGAAGGTGCAGGG + Intergenic
1193805879 X:85993707-85993729 GTGCAGTTGTGGCTGATGCATGG - Intronic
1193820317 X:86154445-86154467 TTGCAGGTTGAGATGGTGAAAGG - Intronic
1196866161 X:120073111-120073133 GTGCAGGTGTAGCTGATGAGTGG + Intronic
1196876936 X:120163170-120163192 GTGCAGGTGTAGCTGATGAGTGG - Intronic
1197808752 X:130422499-130422521 GTGCAGGTCTAGTTAGTACATGG - Intergenic
1198376509 X:136045449-136045471 GTACAGGTGTATATAGTTCAGGG + Exonic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic
1202379373 Y:24262268-24262290 GGGCAGGTGGAGGTGGTGCAGGG + Intergenic
1202491409 Y:25407853-25407875 GGGCAGGTGGAGGTGGTGCAGGG - Intergenic