ID: 952483628

View in Genome Browser
Species Human (GRCh38)
Location 3:33787546-33787568
Sequence CAGCACGACCTTTCGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952483628_952483633 23 Left 952483628 3:33787546-33787568 CCATCCTGCGAAAGGTCGTGCTG No data
Right 952483633 3:33787592-33787614 AGTGACACCTTGTGGGGCAGAGG No data
952483628_952483632 17 Left 952483628 3:33787546-33787568 CCATCCTGCGAAAGGTCGTGCTG No data
Right 952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG No data
952483628_952483630 15 Left 952483628 3:33787546-33787568 CCATCCTGCGAAAGGTCGTGCTG No data
Right 952483630 3:33787584-33787606 GTCTCAACAGTGACACCTTGTGG No data
952483628_952483631 16 Left 952483628 3:33787546-33787568 CCATCCTGCGAAAGGTCGTGCTG No data
Right 952483631 3:33787585-33787607 TCTCAACAGTGACACCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952483628 Original CRISPR CAGCACGACCTTTCGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr