ID: 952483629

View in Genome Browser
Species Human (GRCh38)
Location 3:33787550-33787572
Sequence ACTACAGCACGACCTTTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952483629_952483632 13 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG No data
952483629_952483630 11 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483630 3:33787584-33787606 GTCTCAACAGTGACACCTTGTGG No data
952483629_952483631 12 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483631 3:33787585-33787607 TCTCAACAGTGACACCTTGTGGG No data
952483629_952483633 19 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483633 3:33787592-33787614 AGTGACACCTTGTGGGGCAGAGG No data
952483629_952483635 28 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483635 3:33787601-33787623 TTGTGGGGCAGAGGTAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952483629 Original CRISPR ACTACAGCACGACCTTTCGC AGG (reversed) Intergenic
No off target data available for this crispr