ID: 952483632

View in Genome Browser
Species Human (GRCh38)
Location 3:33787586-33787608
Sequence CTCAACAGTGACACCTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952483629_952483632 13 Left 952483629 3:33787550-33787572 CCTGCGAAAGGTCGTGCTGTAGT No data
Right 952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG No data
952483628_952483632 17 Left 952483628 3:33787546-33787568 CCATCCTGCGAAAGGTCGTGCTG No data
Right 952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952483632 Original CRISPR CTCAACAGTGACACCTTGTG GGG Intergenic
No off target data available for this crispr