ID: 952484217

View in Genome Browser
Species Human (GRCh38)
Location 3:33793278-33793300
Sequence CAGAATAAGGAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952484217_952484225 20 Left 952484217 3:33793278-33793300 CCCTCCACCCTCTCCTTATTCTG No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952484217 Original CRISPR CAGAATAAGGAGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr