ID: 952484225

View in Genome Browser
Species Human (GRCh38)
Location 3:33793321-33793343
Sequence TGCTGCAGAGCTGCCATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952484217_952484225 20 Left 952484217 3:33793278-33793300 CCCTCCACCCTCTCCTTATTCTG No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484215_952484225 27 Left 952484215 3:33793271-33793293 CCTGCGCCCCTCCACCCTCTCCT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484222_952484225 13 Left 952484222 3:33793285-33793307 CCCTCTCCTTATTCTGGGCTAGT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484223_952484225 12 Left 952484223 3:33793286-33793308 CCTCTCCTTATTCTGGGCTAGTT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484224_952484225 7 Left 952484224 3:33793291-33793313 CCTTATTCTGGGCTAGTTGTACT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484216_952484225 21 Left 952484216 3:33793277-33793299 CCCCTCCACCCTCTCCTTATTCT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484221_952484225 16 Left 952484221 3:33793282-33793304 CCACCCTCTCCTTATTCTGGGCT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484218_952484225 19 Left 952484218 3:33793279-33793301 CCTCCACCCTCTCCTTATTCTGG No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data
952484214_952484225 30 Left 952484214 3:33793268-33793290 CCTCCTGCGCCCCTCCACCCTCT No data
Right 952484225 3:33793321-33793343 TGCTGCAGAGCTGCCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952484225 Original CRISPR TGCTGCAGAGCTGCCATTTT AGG Intergenic
No off target data available for this crispr