ID: 952485689

View in Genome Browser
Species Human (GRCh38)
Location 3:33807544-33807566
Sequence CACCTACGGCCCCCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952485689 Original CRISPR CACCTACGGCCCCCTGGGGC AGG Intronic
900117029 1:1033313-1033335 CACCTACGCCCCGCCAGGGCGGG + Intronic
900177413 1:1297087-1297109 CACCTACGTGCCACTGGGGATGG - Intronic
900364617 1:2306004-2306026 CGCCTCCGGCCCCCAGGAGCTGG + Exonic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
900990630 1:6096737-6096759 TACCTATGGCCAGCTGGGGCAGG - Exonic
900990652 1:6096799-6096821 TACCTACGGCCAGCTGGGGCAGG - Intronic
901200287 1:7463080-7463102 CACATAAGGCCTCCTGGGGCCGG + Intronic
902990464 1:20184053-20184075 CTCCTGCCTCCCCCTGGGGCTGG + Intergenic
906567909 1:46813706-46813728 AAGCTAAGGCTCCCTGGGGCAGG - Intronic
907470924 1:54673019-54673041 CACCAGGGGCCGCCTGGGGCTGG + Intronic
911950899 1:104172551-104172573 CACCCACCTCCCCGTGGGGCAGG + Intergenic
915313817 1:155017339-155017361 CCTCTACTGCCCCCAGGGGCAGG - Exonic
917442580 1:175080257-175080279 CAGCTACTACCCCCTGGGGAAGG + Exonic
919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG + Intergenic
920166073 1:204036962-204036984 CACTTACTGTCCACTGGGGCTGG + Intergenic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920701145 1:208218932-208218954 CAGCTTCAGCCACCTGGGGCAGG + Intronic
1073444366 10:103571834-103571856 CCCCTCCGGCCCCTTGGTGCAGG + Intronic
1075406340 10:122198270-122198292 CACCTGCTGCCAGCTGGGGCGGG + Intronic
1075802723 10:125162330-125162352 CTCCTCCGGCCCCCTGGCCCTGG - Intergenic
1076743043 10:132497552-132497574 CCCCTGGGGCCCCTTGGGGCTGG - Intergenic
1076754136 10:132559174-132559196 CACCGACGGCCCCGAGCGGCGGG - Intronic
1076805716 10:132857703-132857725 CAGCTACGGCACCCTGGGCCAGG + Exonic
1077008481 11:369887-369909 CACCTACGTGCACCTGGGCCTGG + Exonic
1077240473 11:1508015-1508037 ACCCCACGGCCCCCTGGAGCTGG + Intergenic
1077664343 11:4094544-4094566 CACCTAGAGCCCGCTGGGTCAGG - Intergenic
1081567901 11:44270968-44270990 CCCCTGCAGCCCCCTGGAGCAGG + Intronic
1081873359 11:46392937-46392959 CACCTCCGGCCCTCGGGGGAGGG - Intergenic
1083306883 11:61766043-61766065 CACCTGAGCCCCCCTGGGGGTGG + Exonic
1083484873 11:62977001-62977023 TACCTACTGCTCCCTGGAGCTGG + Intronic
1083768473 11:64853501-64853523 CACCTAATGCCCCCTGGGCAGGG + Exonic
1084172177 11:67405966-67405988 CAGCCACGGGCCCCTGGGCCTGG - Exonic
1084265517 11:68003514-68003536 CAGCCACGGCCCCCCGCGGCGGG - Intronic
1084559112 11:69892836-69892858 CACACACTGCCCCCTGCGGCTGG + Intergenic
1084706036 11:70816497-70816519 CACCCAGGGCCCCCAGAGGCTGG + Intronic
1084726431 11:70945426-70945448 CACCTACGGCCTCATGTGGAAGG + Intronic
1089349589 11:117814806-117814828 CCCCTCCTGCCCCCTGGGGCGGG + Intronic
1090438219 11:126704429-126704451 CCCCTACAGCCAGCTGGGGCTGG - Intronic
1092238564 12:6824183-6824205 CACCTACTACACCCTGGCGCTGG + Exonic
1093583255 12:20807578-20807600 CAGCTGCCTCCCCCTGGGGCAGG - Intergenic
1094065684 12:26358733-26358755 CACTTAAGGCCCCCTGGGCTAGG - Intronic
1097719389 12:63003447-63003469 CACCTTCAGCCCTCTGTGGCGGG - Intergenic
1102182499 12:110923022-110923044 AACAGAAGGCCCCCTGGGGCTGG + Intergenic
1103320609 12:120090770-120090792 CTCCCAGGGCCCCATGGGGCTGG + Intronic
1103867545 12:124064748-124064770 ACCCAACAGCCCCCTGGGGCAGG - Intronic
1105812109 13:24004617-24004639 CACCTGCGTCTTCCTGGGGCAGG - Intronic
1114516108 14:23301383-23301405 CACCAAAGGCACCCGGGGGCGGG - Exonic
1122799457 14:104222427-104222449 CACCTGCTGCTCCCTGGGCCAGG + Intergenic
1124619179 15:31264459-31264481 CCCCTGCCGCCCCCTGGAGCTGG - Intergenic
1128520744 15:68373147-68373169 CACCGACGGCTTCCTGGAGCAGG - Intronic
1128995026 15:72289355-72289377 CAGGTACGGCCCCCAGGGACTGG - Exonic
1129394645 15:75237293-75237315 CAGCTTCAGCCCCCTGGGCCAGG + Intergenic
1131527831 15:93166759-93166781 GACCTTCGGCTCCCTGGGGATGG - Intergenic
1132345744 15:101107700-101107722 CACCCCCGGTCCCCTAGGGCCGG + Intergenic
1132539177 16:500273-500295 GACCTACTGCCCTGTGGGGCAGG + Intronic
1132728281 16:1348228-1348250 CACCCCCGCCCACCTGGGGCCGG - Exonic
1132764299 16:1526548-1526570 CAGCCACGGCCCCCTGGGGAAGG - Intronic
1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG + Exonic
1134523772 16:14929776-14929798 CACCGACGGAGGCCTGGGGCTGG - Intronic
1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG + Intronic
1134711363 16:16328261-16328283 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134719213 16:16371564-16371586 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1137950259 16:52776854-52776876 CACCTGCGGCCCGAGGGGGCAGG - Intergenic
1141600729 16:85124444-85124466 CACTTCAGGCCCCCTGGGGCTGG - Intergenic
1142131380 16:88433061-88433083 CACTGACTGCCCCCCGGGGCAGG + Exonic
1142593992 17:1020820-1020842 CACCTCTCACCCCCTGGGGCAGG + Intronic
1145263126 17:21366401-21366423 CATCTCCAGCCCCCTGGAGCTGG - Intergenic
1148698039 17:49572885-49572907 CAACTAAGGCTCCCTGGGGATGG + Intergenic
1150002700 17:61451758-61451780 CGCCCGCGGCCCCCTGGGCCGGG + Intergenic
1151490700 17:74431092-74431114 CCCCTACGGGCCTCTGGCGCGGG + Exonic
1152235221 17:79135113-79135135 CACCTGCTGCCCCCTGGGCCAGG - Intronic
1152264656 17:79287319-79287341 CACCCAGGGCCCCCTGTGGGTGG - Intronic
1152710070 17:81867017-81867039 CACGCAGGGCCTCCTGGGGCAGG - Intergenic
1152801381 17:82332429-82332451 AAGCTCCGGCCCCCTCGGGCTGG + Intronic
1153348967 18:4058033-4058055 CACTTATGGCCCTCTGGGACAGG + Intronic
1154132619 18:11750317-11750339 CACCTGCGGCACCGTGGGGGCGG + Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1158391918 18:57051301-57051323 CACCAAGGACCCACTGGGGCAGG - Intergenic
1158684478 18:59600710-59600732 CTCCTCCTGCCCACTGGGGCTGG + Intronic
1160915453 19:1494327-1494349 CACCCAGTGTCCCCTGGGGCGGG - Intronic
1160991015 19:1860333-1860355 CACCTCCCGTCCCCTGGGTCTGG - Intronic
1161701785 19:5799914-5799936 GACCTAAGGCCCCCAGGGACGGG + Intergenic
1162345122 19:10114282-10114304 AGCCTACGGCGCCCTCGGGCGGG + Exonic
1162951132 19:14072717-14072739 CAGGAACGGCCCCCGGGGGCAGG - Intronic
1163422245 19:17220360-17220382 CTCCTAGGGCCTCCTGGGGCTGG - Intergenic
1166231698 19:41428432-41428454 CACATCCAGCCCCTTGGGGCAGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
925586577 2:5470545-5470567 CATGTACTGCCTCCTGGGGCTGG - Intergenic
926159627 2:10478397-10478419 CACCTAGGGCCTCCAGGAGCTGG + Intergenic
926953676 2:18271550-18271572 CACCTTCAGGCCCCTGGAGCAGG - Intronic
927713891 2:25341085-25341107 CTCCTCCGGCCACCTGTGGCTGG - Intronic
927809130 2:26172493-26172515 CACCTCCGGCTCCGTGGAGCTGG - Intergenic
931671684 2:64653702-64653724 CACCCTCGGGCCCCTGGAGCGGG - Exonic
932494049 2:72137862-72137884 CACCTGCAGGCCCCTGAGGCTGG + Intronic
933759450 2:85663835-85663857 CAGCTAGCGCACCCTGGGGCGGG + Exonic
933793400 2:85901807-85901829 CAGCTACTGCCAACTGGGGCAGG - Intergenic
934619971 2:95797901-95797923 CACCTAGGGGCCCAAGGGGCTGG - Intergenic
934640917 2:96026656-96026678 CACCTAGGGGCCCAAGGGGCTGG + Intronic
934728074 2:96638046-96638068 CGCCTCCCGCTCCCTGGGGCAGG + Intronic
936153764 2:110035521-110035543 CACCTCCTGCTCCCTGGGCCTGG + Intergenic
936190921 2:110335894-110335916 CACCTCCTGCTCCCTGGGCCTGG - Intergenic
938108590 2:128549773-128549795 CACCCACCCCACCCTGGGGCTGG + Intergenic
938277163 2:130037198-130037220 GCCCTACGGCGCCCTGGAGCTGG + Intergenic
938438221 2:131300191-131300213 GCCCTACGGCGCCCTGGAGCTGG - Intronic
944325992 2:198404428-198404450 CACCTGAGGCTCGCTGGGGCAGG + Intronic
947767200 2:232645362-232645384 CAGCTACGGCCCTGTGGGGTGGG - Intronic
947809931 2:232997893-232997915 CACCCACGGCCACCTGTGGGTGG - Intronic
1169068157 20:2706103-2706125 CACCTAATGCCCCCTGTGCCAGG + Intronic
1171947107 20:31388566-31388588 CACCTTCTAACCCCTGGGGCTGG + Intronic
1174540433 20:51285158-51285180 CACTTGCCTCCCCCTGGGGCTGG - Intergenic
1175142844 20:56873541-56873563 CACCTAGGGCCCCAGAGGGCAGG - Intergenic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1175911574 20:62407599-62407621 CACCCACGCCGCCCTGGGTCCGG - Intergenic
1175920644 20:62449162-62449184 CACCTTCGGCCACAGGGGGCCGG - Intergenic
1176087728 20:63305654-63305676 CACATACCCACCCCTGGGGCTGG - Intronic
1176145476 20:63563487-63563509 CCCCTACGGCTCCCTGCAGCTGG - Exonic
1179250048 21:39664715-39664737 CACCCACCACCCCCTGTGGCTGG + Exonic
1179444510 21:41421839-41421861 CACCTAAGTCCACCTGGGCCTGG + Exonic
1179726088 21:43341888-43341910 CACCTTCACACCCCTGGGGCAGG - Intergenic
1180109427 21:45641208-45641230 CAGCTGCTGCCGCCTGGGGCGGG + Intergenic
1180854857 22:19039314-19039336 TACCTACTGCCCCCTGTGGCTGG + Intronic
1180924506 22:19544434-19544456 CACCCACACCCCTCTGGGGCTGG + Intergenic
1181183101 22:21080837-21080859 CACCTCCCGACCACTGGGGCAGG + Intergenic
1182296050 22:29311687-29311709 CTCCTGGGGCCCCCCGGGGCCGG - Intronic
1183264930 22:36819197-36819219 CACCCACCGCCCCCCGTGGCTGG - Intronic
1184489953 22:44802729-44802751 CATCTGGGGCCCCCTGGAGCTGG - Intronic
1185105846 22:48869356-48869378 CACCTGCGGGGCCCTGGGGAGGG + Intergenic
1185138400 22:49086838-49086860 CCCCGACGGCCTCCTGGGGCTGG - Intergenic
950130901 3:10546213-10546235 CCCCAACTGCCCCCTGGAGCTGG + Intronic
952485689 3:33807544-33807566 CACCTACGGCCCCCTGGGGCAGG + Intronic
954640795 3:52096631-52096653 CACTCACGGGCTCCTGGGGCTGG + Exonic
955202128 3:56861000-56861022 CACCTCCAGCCCCCTGCTGCAGG + Intronic
961373834 3:126449498-126449520 CACCTGCAGCAGCCTGGGGCAGG - Intronic
961532538 3:127548009-127548031 CCCCTACGGCCTCCAGAGGCCGG + Intergenic
961772582 3:129260827-129260849 CACCCACGGCCCCCAGAGGAAGG + Intronic
962808691 3:138944872-138944894 CACCTCCGGGCCCCGGCGGCTGG - Exonic
966973337 3:185065273-185065295 CAGCTGGAGCCCCCTGGGGCTGG - Intergenic
968064100 3:195748616-195748638 AACCTACTGCGTCCTGGGGCAGG + Intronic
968317478 3:197736782-197736804 CTCCCGGGGCCCCCTGGGGCCGG + Intronic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968631396 4:1653981-1654003 CATCTACAGCCCCCAGAGGCAGG + Intronic
968956890 4:3724093-3724115 CACCCACGGCCCCCGAGGGTGGG + Intergenic
969526173 4:7705228-7705250 CACCCAGGGCCCCCAGGAGCTGG + Intronic
969600128 4:8171320-8171342 CCCCTGCGGGCACCTGGGGCTGG - Intergenic
979831871 4:125314880-125314902 CAGCTCCGGCCCAATGGGGCTGG + Intergenic
980471271 4:133255234-133255256 TACTTACGGCCCTTTGGGGCTGG + Intergenic
982284935 4:153724875-153724897 TGCCTACTCCCCCCTGGGGCAGG - Intronic
985580372 5:692867-692889 CACCGGCGGCCCCCTAGGCCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
989950593 5:50293073-50293095 CAGCTACCTCCCCATGGGGCAGG + Intergenic
994570318 5:101506251-101506273 CAACTACCTCCCCATGGGGCAGG + Intergenic
998167426 5:139852158-139852180 CACATACTGGCCCCTGGGGCTGG - Intronic
999685859 5:154102387-154102409 CACCTGCAGCCCCCAGGGGCCGG + Intronic
1000040589 5:157481831-157481853 CCACTGCGGCCCCCTGGTGCTGG - Exonic
1004427522 6:15516515-15516537 CAGCCCCGGCCCCCTTGGGCGGG - Intronic
1006358662 6:33575428-33575450 CTCCTACAGCACCATGGGGCAGG - Exonic
1009739300 6:67723277-67723299 CAGCTACCTCCCCATGGGGCAGG + Intergenic
1011052368 6:83167195-83167217 TACTTACGGCACCCTTGGGCAGG - Intronic
1011099937 6:83709218-83709240 CACACACCGCCCCCCGGGGCCGG + Exonic
1013369068 6:109454958-109454980 TACCCACGGCCCCCTGGAGTAGG - Intronic
1014056852 6:117025725-117025747 CCCCTAGGTCCTCCTGGGGCAGG + Intergenic
1019505539 7:1388697-1388719 TACCTACTGCACACTGGGGCAGG - Intergenic
1020024152 7:4886858-4886880 CACCTAAAGTCTCCTGGGGCTGG - Intergenic
1021890207 7:25180067-25180089 CACCTACGGCCCGGTGGAGCTGG + Exonic
1025673757 7:63629230-63629252 TCTCAACGGCCCCCTGGGGCGGG + Intergenic
1029118575 7:98251616-98251638 CACCTCCTGCCCGGTGGGGCTGG - Intronic
1033604360 7:142915021-142915043 CACCTATGCCTCCCTGGTGCTGG - Exonic
1034273269 7:149813378-149813400 TCCCTTTGGCCCCCTGGGGCAGG - Intergenic
1034467423 7:151238268-151238290 CCCCCAGGGCCCCCGGGGGCTGG + Exonic
1034885480 7:154795223-154795245 GACCTCCGGGCCCCTGGAGCAGG - Intronic
1034939722 7:155222697-155222719 CACCTACTGTCCCCTGGGTGGGG + Intergenic
1040311790 8:46240604-46240626 CACCCACGCCACCCTGTGGCCGG - Intergenic
1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG + Intronic
1043729273 8:83653630-83653652 AACCTCCGGCCCCCGGTGGCAGG - Intergenic
1045047630 8:98294276-98294298 CACCTACGGCCGCGCGGGGGCGG - Exonic
1049228169 8:141467577-141467599 CACCTTGGGCCCCCTGGGCCTGG + Intergenic
1049345304 8:142135683-142135705 CACCTGGGGCCCTCTGGGGCTGG + Intergenic
1049443140 8:142618242-142618264 CATCTACTGCCCGGTGGGGCTGG + Intergenic
1049688119 8:143947131-143947153 CACCTAGAGCACCCTGTGGCTGG + Intronic
1049828427 8:144685173-144685195 CACTCACACCCCCCTGGGGCCGG + Intergenic
1053281567 9:36823486-36823508 CACCAAGGGCCCCTTGGAGCTGG - Intergenic
1057550828 9:96049978-96050000 CCCATACCGCCCCCTGGGACTGG + Intergenic
1058759718 9:108119255-108119277 CAACGAAGGCCTCCTGGGGCAGG + Intergenic
1060033144 9:120232861-120232883 CTCCAAGGGCCACCTGGGGCAGG - Intergenic
1060222767 9:121773308-121773330 CACCTCCTGCCCCCCGCGGCCGG + Exonic
1060804059 9:126563918-126563940 CACCTGCTGCTCCCTGAGGCTGG - Intergenic
1061132263 9:128714689-128714711 CTCCTAGGGCCGGCTGGGGCTGG + Intronic
1061253075 9:129437754-129437776 CAGGTAGGGCCCCCTGGGGCTGG - Intergenic
1061396600 9:130347023-130347045 CACCTCCGTCCCCCCGAGGCTGG - Intronic
1061911870 9:133729289-133729311 CACCTCCTGGCACCTGGGGCTGG - Intronic
1062162264 9:135087154-135087176 CCCCGACGCCCCCCTGGCGCTGG + Intronic
1062422949 9:136492776-136492798 CACCTGCGGCCCTTTGCGGCCGG + Intergenic
1062623715 9:137433833-137433855 CAGCTGCAGCCCCCTGGGGCAGG - Exonic
1186744645 X:12554959-12554981 GACCTACGGCCCCCCAGAGCAGG - Intronic
1190456863 X:50635383-50635405 CAACTAAGGCCCCCAGTGGCCGG - Exonic
1199691493 X:150312229-150312251 CACCTAGGGCCACCAGAGGCTGG + Intergenic