ID: 952486500

View in Genome Browser
Species Human (GRCh38)
Location 3:33816853-33816875
Sequence GAGAATAAGGAGCAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952486500 Original CRISPR GAGAATAAGGAGCAGATGGC AGG Intronic
900403178 1:2481169-2481191 GAGAACAGGCAGCAGCTGGCAGG - Intronic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
901007737 1:6179944-6179966 GAGAATGAGGACGAGATGTCAGG - Exonic
901944986 1:12694581-12694603 AAGAATAATGAACAGCTGGCTGG + Intergenic
902013928 1:13290852-13290874 GAAAATGAGCAGCAGATTGCAGG - Intergenic
902071812 1:13746112-13746134 GAGAATATGGAGCAGATTCTTGG + Intronic
903391317 1:22965355-22965377 CAGAAGAAGCTGCAGATGGCCGG + Intergenic
903854557 1:26329027-26329049 GAGAATCAGGAGCACTCGGCTGG - Intronic
904813611 1:33180268-33180290 GAGAATAAGGCCCAGATGTAAGG - Intronic
905622211 1:39458011-39458033 GAGAAAGAGGAGGAGATAGCAGG + Intronic
905940084 1:41856294-41856316 GAAAAGAAGGAGCAGATGGGTGG + Intronic
907309944 1:53533533-53533555 GGGTATAATGAGCAGCTGGCTGG + Intronic
908403283 1:63790708-63790730 GAGAAAAAGGTGCTGAGGGCCGG - Intronic
909740476 1:79023649-79023671 GAGAAAAAGGAGCAGGTGAAAGG - Intergenic
909862792 1:80630134-80630156 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
911320123 1:96403782-96403804 GAGATTAAGTAGCAGTTGTCCGG + Intergenic
911583037 1:99657455-99657477 AACAAGAAGGAGCAGAGGGCAGG - Intronic
913707391 1:121440334-121440356 AAAAATAAGCAACAGATGGCTGG + Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
919678197 1:200408444-200408466 GAAAATAAGGAACAGAAGACCGG - Exonic
919861067 1:201739869-201739891 GAGAAAAGGGAGCGGAGGGCAGG + Intronic
920624725 1:207585839-207585861 GAAAATATGCAGCACATGGCTGG + Intronic
920669010 1:207988799-207988821 GAGAAGGAGGAGAAGATGGCGGG - Intergenic
920968777 1:210724416-210724438 GAGAAAAATGAGCAGAGGCCTGG - Intronic
922059691 1:222076300-222076322 TAGAATAAGAATAAGATGGCTGG - Intergenic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923394220 1:233544629-233544651 GTGAATCAGGAGCAGAGGGAAGG - Intergenic
1064366644 10:14714435-14714457 GAAAATAAGATGCAAATGGCTGG + Intronic
1064909633 10:20385711-20385733 AAGAATATAGAGCAGATGGGAGG + Intergenic
1064947838 10:20811978-20812000 GACTATAAGGAACAGATAGCAGG + Intronic
1065467978 10:26045688-26045710 GAGCAAAAGGAGCAGATGAAAGG - Intronic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066053504 10:31659554-31659576 GAGAAGAAGGAGCATATGCCTGG + Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1066307248 10:34157474-34157496 GAGAAAAAGGTGCACATGGCTGG - Intronic
1067215793 10:44301619-44301641 GAGAGAAAGGAGCAGAAAGCTGG + Intergenic
1069702296 10:70435589-70435611 GAGCATAAGGAGCACATTGGTGG + Exonic
1069942294 10:71964200-71964222 GAGGAGAAGGAGGAGCTGGCGGG - Intergenic
1070171332 10:73935110-73935132 GAGAATAAGTTGTAGAGGGCAGG + Intergenic
1070360388 10:75682862-75682884 GAAAAAATGGAGCAAATGGCTGG + Intronic
1071496709 10:86172704-86172726 TAGAGAGAGGAGCAGATGGCAGG - Intronic
1075330149 10:121568122-121568144 GAGAAGGAGGAGAAGACGGCAGG + Intronic
1075390357 10:122086917-122086939 GAGAAGAAGCAACAGTTGGCTGG + Exonic
1076599161 10:131645954-131645976 GAGGAAAAGGAGCAGGTGGAGGG - Intergenic
1076605145 10:131684507-131684529 GAGTATAAGGTGCATATTGCAGG + Intergenic
1077146623 11:1049346-1049368 GAGGCCAAGGAGCAGAGGGCTGG - Intergenic
1077160563 11:1110666-1110688 GAGAATGGGGAGCGGAGGGCAGG - Intergenic
1079541431 11:21580503-21580525 AAGCATAAGGAGCTGCTGGCAGG + Intergenic
1080704708 11:34679517-34679539 TAGAATAAGGAGGTGATGCCTGG + Intergenic
1081804058 11:45880518-45880540 GAGAATCAGGAAAAAATGGCTGG - Intronic
1083231527 11:61324022-61324044 GAGAAGGAGGAACAGATGGATGG - Exonic
1083396364 11:62395361-62395383 GATAATAAGGAGCACAAGACGGG + Intergenic
1083893079 11:65606639-65606661 GAGAATAAGGAGCTGGGGGGCGG + Intronic
1086056117 11:82649068-82649090 GAGAAGAAGGAGCAGAAGAAAGG - Intergenic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1087340666 11:96901921-96901943 GAGTATAAGGAGAAAATGGTAGG + Intergenic
1088826208 11:113496407-113496429 AAGAGTGAGGAGCAGAAGGCAGG + Intergenic
1089364693 11:117914518-117914540 GAGAAAAAGAAGCAGACAGCTGG + Intronic
1090014277 11:123072006-123072028 GAGAATAAGTAGTGGGTGGCAGG - Exonic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1092763668 12:11832641-11832663 GAGGATGAGGAGCAGATGGCTGG - Intronic
1092884123 12:12910789-12910811 GAGAGTAAGGAACATATGACAGG - Intronic
1093716844 12:22392264-22392286 GAGAATCAAGTACAGATGGCAGG + Intronic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097494445 12:60313222-60313244 GACAATTTGGAGCAAATGGCTGG + Intergenic
1097734828 12:63170567-63170589 AAGAATGAGGAGCAGTTGACAGG - Intergenic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1102414038 12:112744995-112745017 GAGAATAAAGAGAAGATTACTGG - Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1105635158 13:22209327-22209349 GGGAATGAGGAAGAGATGGCAGG + Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106931491 13:34670581-34670603 GAGAAAAAAGAGGAGATGGGAGG + Intergenic
1108910515 13:55545406-55545428 GAGAAAAAGGAGAAAATGGTAGG + Intergenic
1109232432 13:59774916-59774938 GAGAAAAAAGATCAGATGCCAGG + Intronic
1109998440 13:70162085-70162107 GAGAAAAAGGAAGAGATGGAGGG + Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110429264 13:75404899-75404921 GAGGATAAGCAGCAGCTGGTGGG - Intronic
1111905318 13:94249012-94249034 GAGAATCAGGAGCAGCTTTCTGG + Intronic
1118377439 14:65189429-65189451 GAGATTCTGGAGCAGATGGTAGG + Intergenic
1119644130 14:76336412-76336434 GAGAGCAGGCAGCAGATGGCTGG + Intronic
1119706381 14:76785102-76785124 GAGAATGAAGAGCAGGTGGATGG + Intergenic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1119966829 14:78925855-78925877 GAGAAGAAGCAGCAGATTTCTGG - Intronic
1120163257 14:81168131-81168153 GAGAAAAAGGAGCAGGTGCAAGG - Intergenic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1121019964 14:90573753-90573775 GTGAAGCAGAAGCAGATGGCAGG - Intronic
1121272355 14:92646369-92646391 AAGAAAAAGCAGCACATGGCGGG - Intronic
1121331959 14:93055397-93055419 GAGAGTAAGGGGCTGAGGGCTGG - Intronic
1122055550 14:99095932-99095954 GAGAGTCAGCAGCAGAGGGCAGG - Intergenic
1122059062 14:99124561-99124583 GAGAAGGAGCAGCAGAGGGCAGG + Intergenic
1124753295 15:32387362-32387384 GAGAAAAGGGAGCAGAGAGCTGG - Intergenic
1125215629 15:37270323-37270345 CAAAATAACTAGCAGATGGCAGG - Intergenic
1125403254 15:39326755-39326777 GAGAGTTATGAGCAGATGGAGGG - Intergenic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1127943956 15:63730733-63730755 GAGAGTAAATTGCAGATGGCTGG - Intronic
1128513209 15:68326356-68326378 GAGAACTAGGAGCAGCTGGTGGG - Intronic
1128649255 15:69398548-69398570 AAGAATAAAGCCCAGATGGCAGG + Intronic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129750389 15:78058834-78058856 GAGAATTGGGAGCCGATGCCAGG + Intronic
1133898246 16:9949517-9949539 GAGAAAAATGAACAGATGGATGG + Intronic
1134099128 16:11439310-11439332 TAGAATCAAGAACAGATGGCAGG - Intronic
1134773150 16:16828380-16828402 AAGAAAAAGTAGCAGATGTCAGG + Intergenic
1134905401 16:17975665-17975687 GAGAATATGGAGAAGATGCTTGG - Intergenic
1135059000 16:19255138-19255160 GAGACTCAGGAGCAGGTGGGAGG - Intronic
1135804967 16:25534397-25534419 GAGAATAAGGATGAACTGGCCGG + Intergenic
1136131294 16:28223433-28223455 GGGAATAAAAAGCTGATGGCCGG - Intergenic
1138129398 16:54466869-54466891 GAGAATAAGGATAAGATGCTGGG + Intergenic
1138266518 16:55663779-55663801 GAGATAAGGGAGCAGATGGAAGG - Intronic
1140329176 16:74036572-74036594 GAGAACAGGGAGGAGATCGCAGG - Intergenic
1140600707 16:76471674-76471696 GAGTATAAGGAACAAAGGGCAGG - Intronic
1140840443 16:78833415-78833437 GAGGAGGAGGAGGAGATGGCTGG - Intronic
1141045870 16:80715767-80715789 GAGAGTGAGGAGGAGATGGAAGG - Intronic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1141236055 16:82217569-82217591 GGGAATAAGGAGCAGCAGGTTGG + Intergenic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143409929 17:6702743-6702765 GAGGATAGGGAGCTGATGTCAGG - Intronic
1143795144 17:9330237-9330259 GAGAATAAAGAACAGTTGGAAGG - Intronic
1144265079 17:13561324-13561346 GAAAATCAGGAGCAGAGGGAAGG - Intronic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144623688 17:16833731-16833753 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1144882742 17:18438985-18439007 GAGTGTGAGGAGCAGGTGGCTGG + Intergenic
1145149491 17:20505401-20505423 GAGTGTGAGGAGCAGGTGGCTGG - Intergenic
1146057512 17:29588849-29588871 GAGGGCAAGGAGCAGAGGGCCGG - Intronic
1146375252 17:32289412-32289434 GGGAAAAAGGAGCAAATGACTGG - Intronic
1146651441 17:34609293-34609315 GAGAAAAAGGATGAGATGGACGG + Intronic
1147328016 17:39679239-39679261 GAGAAAAAGCAGCAGATGGCCGG - Intronic
1147500095 17:40954830-40954852 GAGAGTGAGGAGCAGAAGACGGG + Intergenic
1147578022 17:41613663-41613685 GAGTGTGAGGAGCAGGTGGCTGG - Intronic
1147680018 17:42236912-42236934 GTAAATAAGCAGAAGATGGCGGG - Intronic
1147813313 17:43189564-43189586 TAGAATATGGAGCAGAAGGTAGG - Intronic
1148435253 17:47679220-47679242 GAGAAAAAGAAGCAGAGGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149649745 17:58269327-58269349 GAGAAGGGAGAGCAGATGGCTGG - Intergenic
1149781020 17:59396702-59396724 GAGAAGCAGGGGCAGATGACAGG - Intronic
1150453283 17:65287278-65287300 GAGAAGGAGGGGCAGAGGGCAGG + Intergenic
1151925028 17:77189247-77189269 GAGAACAGAGAGCAGATGGGTGG + Intronic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153591642 18:6680188-6680210 CAGATTGAGAAGCAGATGGCCGG - Intergenic
1156580355 18:38367875-38367897 GAGAACAAGGAACATAAGGCAGG + Intergenic
1156634058 18:39006441-39006463 AAGAATAAGTATCAGAGGGCCGG - Intergenic
1157556306 18:48615316-48615338 GAGAAGAAGGAGCAGAGAGAGGG - Intronic
1157618599 18:49002372-49002394 GAGAACAAGAAGCAAATTGCAGG + Intergenic
1158875956 18:61734840-61734862 GAGTATAAGGAGCCCATGGTGGG - Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1160669808 19:355800-355822 GAATATTAGGAGCAGGTGGCCGG - Intergenic
1161793966 19:6375989-6376011 GGGCAGAAGGAGCAGATGCCTGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164441259 19:28282346-28282368 GAGAATGGGGAGAAAATGGCAGG - Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165889663 19:39103386-39103408 GAGAATAAGGAGGGGATGAGTGG - Intronic
1167832652 19:52038683-52038705 GAGAACATAGAGCATATGGCAGG - Intronic
925169249 2:1740824-1740846 GAGAATGAGGAGCAGCTGTCTGG + Intronic
925288260 2:2729923-2729945 GAGATTGAGTAGCAGAAGGCAGG + Intergenic
925781157 2:7382983-7383005 GAGGATAAGGCTCAGATGTCTGG + Intergenic
927494439 2:23543112-23543134 GAGGATGAGGCGCAGACGGCAGG - Intronic
928663517 2:33527751-33527773 GATAAAGAGGAGCAGATGACTGG - Intronic
928727403 2:34191168-34191190 GGGAATTAGCAGCAGATGGTGGG - Intergenic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
931084091 2:58809697-58809719 AAGAAAATGGAGCAAATGGCAGG + Intergenic
931680958 2:64750096-64750118 GTGAATAAGGAGCTGAGGGGCGG + Intronic
931840875 2:66146742-66146764 GAGGACAAGTAGCAGATGGAGGG - Intergenic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
933266617 2:80187704-80187726 GAGAAAGAGGGGCAGATGGTTGG + Intronic
935182500 2:100703429-100703451 GAGTTTATGGAGCAGATGTCAGG + Intergenic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
936629744 2:114189398-114189420 GAGAATGAAGCACAGATGGCTGG + Intergenic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
936916366 2:117642936-117642958 GGGAATAAGGACCTGATGGCAGG - Intergenic
937420635 2:121752334-121752356 AATAATAAAGAGCAGACGGCCGG + Intronic
938068624 2:128294925-128294947 GAAAATAAGAAGCAGTTGCCAGG + Intronic
938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938359895 2:130678757-130678779 GAGAATGGGGAGCACAAGGCTGG - Intergenic
938436304 2:131285478-131285500 GAGAATGGGGAGCACAAGGCTGG - Intronic
940130111 2:150371422-150371444 TGGAATAAGGAGCACATGGTTGG + Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
944160460 2:196654004-196654026 GAGAAAGAGGAGGAGATGCCAGG + Intronic
945647909 2:212523618-212523640 GATGATGAGGAGCAGATGGGTGG + Intronic
945960227 2:216125783-216125805 GAGAAACAGCAGGAGATGGCCGG - Intronic
946382966 2:219361499-219361521 GAGAATCAGGAGCAGAATCCAGG + Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
948012525 2:234661365-234661387 GGGCTCAAGGAGCAGATGGCTGG + Intergenic
948771574 2:240253854-240253876 AAGAATTAGGACCAGATGGATGG + Intergenic
948782164 2:240328599-240328621 GCGAATAAGGAGGAGTTGGGTGG - Intergenic
1169812386 20:9621288-9621310 AATAAAAAGGAACAGATGGCGGG + Intronic
1170570540 20:17629822-17629844 GAGCAACAGCAGCAGATGGCCGG - Exonic
1170662648 20:18358175-18358197 GAGGAAAAGGAGGTGATGGCTGG + Intergenic
1171065234 20:22008723-22008745 GAAAATAGGGAGCAGATTTCTGG + Intergenic
1173033660 20:39387890-39387912 CAGAGTCAGGAACAGATGGCAGG - Intergenic
1173688423 20:44940204-44940226 GATAACCAGGAGCTGATGGCAGG - Intronic
1174183122 20:48687331-48687353 GAGAAGGAGAAGAAGATGGCGGG - Intronic
1175643441 20:60650852-60650874 GAGACTGAGAAGCAGAGGGCGGG + Intergenic
1175682142 20:60996682-60996704 GAAAAGAGGGTGCAGATGGCAGG - Intergenic
1176007288 20:62873060-62873082 GAGAAGAGAGAGGAGATGGCGGG + Intergenic
1179078508 21:38147378-38147400 GAGAACAAGTAGCAGATGTTGGG - Intronic
1179273482 21:39869532-39869554 GAGGATGAGGAGCAGAGAGCTGG - Intronic
1179675992 21:42982431-42982453 AAGAAAAAGGAGCATAAGGCCGG + Intronic
1180629022 22:17214531-17214553 GAGGATAAGGAGCTAATGCCAGG + Intronic
1180734051 22:18002333-18002355 GAAAATATAGAGCAGAGGGCGGG + Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1183533677 22:38381345-38381367 GAGCATAAGGAGCTAATGGAGGG - Intronic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183858721 22:40653630-40653652 GAGAGTAGGGAGCCGAGGGCAGG + Intergenic
1184361454 22:44021387-44021409 GAGAAAAAGGAGCAGGTGAAAGG + Intronic
1184852470 22:47128318-47128340 GAAAATGTGGAGCAGATGGGTGG - Intronic
949390421 3:3556288-3556310 AAGAAAAAGAAACAGATGGCCGG - Intergenic
951134596 3:19089865-19089887 GAGAAAAAGGAAGAGATGGAGGG + Intergenic
952106804 3:30079347-30079369 GAGAAAAAGGAACCTATGGCAGG + Intergenic
952131597 3:30370420-30370442 CAGAGTCAGAAGCAGATGGCAGG + Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
953031591 3:39183483-39183505 GGGATTAAGGAGCAGATGGCTGG + Exonic
953369350 3:42374145-42374167 CAAGATAAGGAGCAGATGGAAGG - Intergenic
953612470 3:44458701-44458723 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
953708439 3:45248675-45248697 GAGAAGAAGGATCAAATGGAAGG + Intergenic
954327493 3:49871410-49871432 AAGAATAGTGGGCAGATGGCAGG - Intergenic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
955997850 3:64696266-64696288 GAGAATAAGAAGCAGCCGGCCGG + Intergenic
958456661 3:94340365-94340387 GAGAATAAAGATGAGATGGAAGG + Intergenic
959526298 3:107381245-107381267 GAAAAACAGGAGCAGAGGGCGGG + Intergenic
960639098 3:119810032-119810054 GAGAATGGGGAGCAGAAGGGGGG - Intronic
961838409 3:129684801-129684823 GAAAATTAGGAGCAGATAGATGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961908183 3:130284521-130284543 GAAAATAAGGATCAGAGGGCTGG + Intergenic
963173098 3:142271075-142271097 TACAATAGGGAGCAGACGGCCGG + Intergenic
964144987 3:153449077-153449099 AAGAATAAGGGGTAAATGGCAGG - Intergenic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
967268183 3:187710180-187710202 GAGAATCAGGAGTTGAGGGCAGG - Intronic
967690402 3:192467226-192467248 GAGAATTAGGAGCAGAACCCAGG - Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
969126522 4:4952449-4952471 GGGAATGAGGAGGAGATGGGAGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969520792 4:7676752-7676774 GAGAGGAAGGAGGAGATGACAGG - Intronic
969520806 4:7676847-7676869 GAGAGGAAGGAGGAGATGACAGG - Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
971271055 4:25146249-25146271 GAACAGAAGGAGCAGATAGCTGG + Intronic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972176787 4:36417883-36417905 GAGACTTGGGAGCAGATGACTGG + Intergenic
973095107 4:46187693-46187715 GAGAATAAGAAACAAATGGCCGG + Intergenic
974021803 4:56698219-56698241 AAGAAGAAAGAGGAGATGGCTGG + Intergenic
974362582 4:60901479-60901501 GAGAGCAAGGAGCAAATGGCTGG - Intergenic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976737917 4:88329195-88329217 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
976839053 4:89409576-89409598 GAGAAAGAGGAACAGATGGAGGG + Intergenic
978676119 4:111318312-111318334 AAGAAAAAGAAGCAGATGGAGGG + Intergenic
979939381 4:126740786-126740808 GAGACTAGAGAGCAAATGGCTGG - Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
982082762 4:151806627-151806649 AAGAGTGAGGGGCAGATGGCTGG - Intergenic
982338698 4:154270512-154270534 AAGAAGAAGGTGGAGATGGCAGG + Intronic
983874931 4:172864268-172864290 GGGGATAAGGAGCAGATGAATGG - Intronic
985698391 5:1356162-1356184 GACACCAAGAAGCAGATGGCAGG - Intergenic
985937659 5:3109094-3109116 CTGAATAATGAGCAAATGGCAGG + Intergenic
987172935 5:15277509-15277531 TATAAGAATGAGCAGATGGCGGG + Intergenic
987301355 5:16600485-16600507 GAGAACAGGGAGCTGATGCCAGG + Intronic
988712752 5:33794491-33794513 GAGAATAAGCTGCAGCAGGCTGG - Intronic
988723278 5:33900497-33900519 GAGAAAAAGGAGCCAATGGCCGG + Intergenic
989485736 5:41989757-41989779 ATGAATAAGGAGCAGATGATAGG - Intergenic
989970272 5:50515545-50515567 AAAAATAAGCAACAGATGGCTGG - Intergenic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
994397799 5:99240504-99240526 GAGAATAAAGAGAACATGGATGG + Intergenic
996215345 5:120859124-120859146 GAGAATGAGAGGCAGGTGGCAGG - Intergenic
996905644 5:128596691-128596713 GAGAAAAAGAACCAGATGGCGGG + Intronic
997998380 5:138604672-138604694 GAGAATTAGGAGTAGAACGCAGG - Intergenic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
999774580 5:154802121-154802143 GAGGAGATGGAGCAGATGGATGG + Exonic
1001535823 5:172497209-172497231 TAGAATCAAGGGCAGATGGCCGG + Intergenic
1001953962 5:175835575-175835597 GGAAATAAGGTGCAGATGGTTGG - Intronic
1003498462 6:6684803-6684825 GAGAAGAAAGAGCTGATGGTGGG + Intergenic
1003510972 6:6780065-6780087 GAGAACAAGGAGTAGAAAGCTGG + Intergenic
1004853014 6:19719785-19719807 AAAGACAAGGAGCAGATGGCCGG + Intergenic
1004882059 6:20018870-20018892 GAGAAAAAGGAAGAGATGCCAGG + Intergenic
1004993763 6:21168231-21168253 GAGGAGGAGGAGCAGAAGGCTGG - Intronic
1006184993 6:32176417-32176439 GGGAATAAGCAGCAGATAACCGG - Intronic
1007637341 6:43307503-43307525 GAGAATGTGAAGCAGAGGGCTGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1009473416 6:64056889-64056911 GATAAAAAGGAGGAGATTGCAGG - Intronic
1011837354 6:91450007-91450029 GAGAATAAGGAGTTGAAGACAGG - Intergenic
1012188986 6:96257942-96257964 TAGAGGAGGGAGCAGATGGCTGG - Intergenic
1012252727 6:96996935-96996957 GTAAGCAAGGAGCAGATGGCTGG + Intronic
1013165637 6:107589280-107589302 GATGATCAGGAGCACATGGCTGG + Intronic
1014249084 6:119097792-119097814 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
1015360567 6:132334478-132334500 GATGAGAAGGAGCAGATGACAGG - Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1018429746 6:163713528-163713550 GAGAATGAGGAGGAGAGGGTTGG - Intergenic
1020821358 7:12972208-12972230 GAGGATGAGGAACTGATGGCAGG - Intergenic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1022011005 7:26308216-26308238 GAGAAAAAGGAGCAGGTTGAAGG - Intronic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023639966 7:42247562-42247584 CAGAATAAGAAGCAGACGCCTGG - Intergenic
1024632313 7:51260037-51260059 GAGAAGAAGGAGCAGAGGAAAGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029572103 7:101376771-101376793 GTGATTGAGGAGCAGATGGGAGG + Intronic
1031063953 7:117083894-117083916 GTTAATAAGGAGGAGATGGGAGG - Intronic
1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG + Intergenic
1032733620 7:134669460-134669482 GAGAAAAAGGAGGGGATGGAAGG - Intronic
1032836561 7:135680670-135680692 AAGAGAAAGGAGCTGATGGCCGG + Intronic
1033154603 7:138946106-138946128 GAGAAAAGGGAGCAGATGAGAGG - Intronic
1034104814 7:148481395-148481417 GAGACTAATGACCAGATGGTTGG - Intergenic
1035522248 8:284253-284275 GGGAACAAGCAGGAGATGGCAGG - Intergenic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1038447312 8:27612934-27612956 GAGGAGGAGGAGAAGATGGCGGG + Intronic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1043573383 8:81630215-81630237 GAGAAAAAGCAGCAGATGAAAGG + Intergenic
1045587833 8:103559254-103559276 GAAAATCAGGATCAGAAGGCTGG - Intronic
1046918826 8:119705872-119705894 GAGAATAAGGATATGATGTCTGG - Intergenic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1047404955 8:124577741-124577763 AAGAACAAGGAGCAGAGGGTGGG - Intronic
1048902075 8:139048462-139048484 TAAATTAAGGAGCATATGGCTGG + Intergenic
1050720622 9:8584893-8584915 GAGAAGAATGAGCAAAGGGCGGG + Intronic
1051989305 9:23131950-23131972 TAGAAAAAGGAATAGATGGCAGG - Intergenic
1054747227 9:68866867-68866889 GGGAAAAAGGTGCAGATGGTAGG + Intronic
1054973233 9:71113413-71113435 GAGGAAAAGGAGCAGATGAGAGG + Intronic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055340814 9:75280887-75280909 GAGAATAACGAGAAGATGATGGG - Intergenic
1055767108 9:79675290-79675312 GAGGGTCAGGAGGAGATGGCAGG - Intronic
1055767223 9:79676505-79676527 GAGGGTCAGGAGGAGATGGCAGG + Intronic
1056672552 9:88642842-88642864 GAGAAGAAGGAGGAGAGGGAGGG - Intergenic
1056712658 9:89003174-89003196 GAGAAGCAGAAGCAGACGGCTGG + Exonic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057383294 9:94587742-94587764 GAGGAGATGGAGCAGATGGGGGG + Intronic
1059363963 9:113770885-113770907 TAGAGTAAGGAGGTGATGGCAGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061812310 9:133169411-133169433 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1062057318 9:134475337-134475359 GAGAACGAGGAGCAGATTCCCGG + Intergenic
1185916087 X:4037033-4037055 GAGAATAAGAAACAGATGTGGGG - Intergenic
1186286041 X:8045187-8045209 GAGAATGAAGAGGAAATGGCAGG + Intergenic
1189345155 X:40235251-40235273 GAGAATAAGTATAAGAGGGCTGG - Intergenic
1189463860 X:41263444-41263466 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1190452696 X:50596930-50596952 GAGAAGAAGCAGCAGCTGACGGG - Exonic
1192090876 X:68154274-68154296 CAGCATAACTAGCAGATGGCAGG + Intronic
1192273107 X:69602367-69602389 TAGGATTAGAAGCAGATGGCAGG + Intergenic
1192362556 X:70448847-70448869 TTGACTAAGGGGCAGATGGCTGG + Intronic
1192486713 X:71533730-71533752 GAGATGAAGGAGGAGATGGAGGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192623850 X:72707512-72707534 GAGAAAAAGGGGCAGAGGCCAGG + Intronic
1197031223 X:121818469-121818491 GAGAAAAAGGAGGAGATTCCAGG + Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199034711 X:143036112-143036134 GATATTAAAGAGCAGATGGATGG + Intergenic
1199860214 X:151794684-151794706 GAGAGCCAGGAACAGATGGCTGG - Intergenic