ID: 952488840

View in Genome Browser
Species Human (GRCh38)
Location 3:33845590-33845612
Sequence TAAGAAGGACACTTTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952488838_952488840 -5 Left 952488838 3:33845572-33845594 CCATGCAGGGCAGTGAGGTAAGA 0: 1
1: 2
2: 1
3: 21
4: 231
Right 952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG 0: 1
1: 0
2: 5
3: 19
4: 241
952488832_952488840 18 Left 952488832 3:33845549-33845571 CCCTTCTGCTAATCCAGCAAAGA 0: 3
1: 0
2: 0
3: 22
4: 190
Right 952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG 0: 1
1: 0
2: 5
3: 19
4: 241
952488836_952488840 5 Left 952488836 3:33845562-33845584 CCAGCAAAGACCATGCAGGGCAG 0: 3
1: 0
2: 1
3: 19
4: 181
Right 952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG 0: 1
1: 0
2: 5
3: 19
4: 241
952488833_952488840 17 Left 952488833 3:33845550-33845572 CCTTCTGCTAATCCAGCAAAGAC 0: 3
1: 0
2: 0
3: 18
4: 163
Right 952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG 0: 1
1: 0
2: 5
3: 19
4: 241
952488831_952488840 22 Left 952488831 3:33845545-33845567 CCATCCCTTCTGCTAATCCAGCA 0: 3
1: 0
2: 2
3: 26
4: 260
Right 952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG 0: 1
1: 0
2: 5
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952488840 Original CRISPR TAAGAAGGACACTTTGATGT AGG Intronic
901833219 1:11906762-11906784 TAAAAAGGACATCTTGAGGTGGG + Intergenic
905987163 1:42296378-42296400 TAGGAAGAACTCTTGGATGTTGG - Intronic
906409802 1:45569317-45569339 TGAGAAGGACACAATGTTGTGGG + Intronic
906473806 1:46153298-46153320 GCTGAAGGACACTTTGAGGTAGG - Intronic
907812628 1:57886866-57886888 TCACAATGACACTTTGAAGTAGG - Intronic
908163339 1:61433712-61433734 TAAGAGTTACACTTTGAAGTAGG + Intronic
908279407 1:62515849-62515871 TAATTAGGACAATTTGATTTTGG + Intronic
908903164 1:68979461-68979483 TAAAAAGGTCAGTTTTATGTAGG + Intergenic
908904621 1:68993880-68993902 TAATAAGGACTCTCTGGTGTTGG - Intergenic
909247837 1:73311062-73311084 TAAGAAGGAAAATTTGGTGTGGG - Intergenic
910117663 1:83750326-83750348 TAAGATTGAGACTTTGTTGTTGG + Intergenic
910729889 1:90383681-90383703 TAAGAAGCACACTTGGAAATTGG + Intergenic
911233370 1:95383704-95383726 TAAGAAAGACAGATGGATGTTGG - Intergenic
913990221 1:143605016-143605038 TAATAAGGACAATTTGTAGTTGG + Intergenic
914380991 1:147116141-147116163 TAATAAGGACAATTTGTGGTGGG + Intergenic
914943265 1:152041375-152041397 TAAGTGGGACAATTTGATGCTGG + Intronic
917734908 1:177911414-177911436 TAACAAGGCCACTCTGTTGTTGG - Intergenic
918658219 1:187055338-187055360 TAAGGAGGAAACTTGGAAGTTGG - Intergenic
918784312 1:188745872-188745894 TAAAAATGACATTTTGATGAAGG + Intergenic
920338844 1:205262759-205262781 AAAGAAGGACACGGGGATGTAGG - Intronic
920775913 1:208936971-208936993 TTAAAAGGAAACTGTGATGTAGG - Intergenic
920889198 1:209966219-209966241 TAATAAAGACACTTTGGTATTGG - Intronic
923328996 1:232905314-232905336 TAAAAAGGGAACTTTGATATAGG - Intergenic
924067431 1:240238947-240238969 TTAGAAGGAGACTTTTGTGTGGG + Intronic
924584528 1:245350480-245350502 TGAGAAGGACACTTTGCACTGGG - Intronic
924692061 1:246362055-246362077 TAAAAAGGACATTTTTTTGTGGG - Intronic
1066602934 10:37126522-37126544 TTAGAAGGAAACTTCGAGGTGGG + Intronic
1067318631 10:45197568-45197590 TAGAAAGGAAACTTTGAGGTGGG - Intergenic
1069222345 10:65900497-65900519 TTAGAATAACACTGTGATGTAGG + Intergenic
1069771751 10:70904861-70904883 TCAGCAGGAAACTTTGATGAGGG + Intergenic
1071868178 10:89761611-89761633 TGAGAAGGACATTTTAATCTGGG + Intronic
1072538411 10:96380417-96380439 TAAGAAAGACCCTTTGCTTTGGG + Intronic
1073715830 10:106106361-106106383 TAAGAAGGAGACTTTGCTCTTGG - Intergenic
1073763641 10:106658025-106658047 TAAGAACGTCACTTTTATTTTGG - Intronic
1074022886 10:109602645-109602667 TTAGAAGGACACTTTGATGCTGG - Intergenic
1077706528 11:4491929-4491951 TAAAAAGGACACTATGATATTGG + Intergenic
1079600811 11:22311562-22311584 TAAGAAACACAGTGTGATGTTGG + Intergenic
1083565277 11:63709989-63710011 TAGGAAGAACTCTTTGATATAGG + Intronic
1084863736 11:72039594-72039616 TGGGAAGGACCCTTTGAGGTGGG - Intronic
1085280692 11:75328525-75328547 TAAGAAGGGCACTTTCATTTGGG - Intronic
1085576781 11:77612274-77612296 TAAGAAGGATGCTTAGATGCTGG - Intronic
1086352600 11:85957814-85957836 TAAGAAGGACAGTTCATTGTAGG - Intronic
1089009621 11:115121910-115121932 TAGAAAGGCCACTTTGATGGTGG + Intergenic
1090778925 11:129989534-129989556 TAAGTAGGAGACTTTCAGGTGGG + Intronic
1095397957 12:41782392-41782414 TAAGTAGAACAATTTGATGCAGG - Intergenic
1095414821 12:41965288-41965310 TGTGAAGGACACTGTGATGCTGG + Intergenic
1095950624 12:47779995-47780017 TCAGAAAGACACTGTGATGGAGG - Intronic
1095998919 12:48113006-48113028 TATGAAGGAGACTTTGAACTGGG + Intronic
1098377891 12:69836932-69836954 TGAGAAAGAAACTTTGAAGTTGG - Intronic
1098404072 12:70105377-70105399 TATGCAGGATACTTTGAGGTGGG + Intergenic
1098977272 12:76915813-76915835 CTAGAAGGACACTTTGCTGAAGG + Intergenic
1100043967 12:90356221-90356243 AAAGAAGCACACTTTGGTGGTGG - Intergenic
1100607348 12:96162531-96162553 TAATAAGGAGAGTTTGGTGTGGG + Intergenic
1101131394 12:101694636-101694658 TAAGAAACACACTTTGACTTTGG + Intergenic
1101307352 12:103542436-103542458 TAAGAAGGCCACATCGATGCAGG + Intergenic
1101672719 12:106891473-106891495 AAAGAAACACACTTTGATCTTGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1105223939 13:18409588-18409610 TTAGAAGGTAACTTTGAGGTGGG + Intergenic
1105410914 13:20170520-20170542 TAAAAAGGACACTGTGGTGGTGG - Intergenic
1107333650 13:39329841-39329863 TAAGAAAGAGCCTTTGATGTGGG + Intergenic
1107396140 13:40019732-40019754 TAAGAGGAACAGGTTGATGTGGG - Intergenic
1108646634 13:52436308-52436330 TTTGAAGGAGAGTTTGATGTAGG + Exonic
1110076173 13:71246346-71246368 TCAGAAGAACACTCTGCTGTAGG - Intergenic
1110921792 13:81096882-81096904 TAAGGAGGACAATGTGATATTGG - Intergenic
1114008086 14:18334414-18334436 TTAGAAGGTAACTTTGAGGTGGG + Intergenic
1114571732 14:23673974-23673996 GAGAAAGGACACTTTGGTGTAGG - Intergenic
1115560170 14:34575544-34575566 TAAAGAGGAAACTTTTATGTAGG + Intronic
1116673189 14:47870682-47870704 TAAGAAGTACAGTTGTATGTAGG - Intergenic
1117742842 14:58835612-58835634 TTAGAAAGATTCTTTGATGTAGG - Intergenic
1119845909 14:77829636-77829658 TAATATGGACTCTGTGATGTTGG - Intronic
1120269317 14:82290911-82290933 TAAGAAGGACATATTGAAGGGGG + Intergenic
1123678190 15:22734152-22734174 TGAGAAGGGCACTTTGATGTGGG + Intergenic
1124330385 15:28808419-28808441 TGAGAAGGGCACTTTGATGTGGG + Intergenic
1131385659 15:92004649-92004671 TTGGAAGGACACTTTGAGTTTGG + Intronic
1132011909 15:98283604-98283626 TCACAATGAAACTTTGATGTGGG - Intergenic
1132756521 16:1487974-1487996 TAAGGAGGACACGGTGATGATGG + Intronic
1134779557 16:16883452-16883474 TCATAATGACACTTTGAGGTAGG + Intergenic
1135254909 16:20933439-20933461 TAAGAAGAGCCCTTTGATGTAGG + Exonic
1135611351 16:23870535-23870557 TTAGAAGGAAACTTTGCTTTAGG - Intronic
1137230960 16:46567919-46567941 TTAGAAGGAAACTTTGAAGTGGG - Intergenic
1138417307 16:56878802-56878824 TAAGGAGGACATTGTGATCTTGG + Intronic
1144005559 17:11096118-11096140 TAAGCAGGACACTATGTGGTAGG + Intergenic
1149470178 17:56909989-56910011 TAAGAACAACACTATGAGGTAGG + Intronic
1150502927 17:65668407-65668429 TAATAAGGTCTCTTGGATGTGGG - Intronic
1153546929 18:6217610-6217632 TAAGAAGTATACATTTATGTTGG + Intronic
1153983356 18:10331578-10331600 AAGGAAGGAGACTTTGATGAGGG + Intergenic
1154475366 18:14749154-14749176 TTAGAAGGAAACTTCGAGGTGGG + Intronic
1154529371 18:15329529-15329551 TTAGAAGGTAACTTTGAGGTGGG - Intergenic
1155648083 18:28105732-28105754 TAAGAACTATACATTGATGTGGG - Intronic
1157010390 18:43641375-43641397 TAACAAGAACTCTTTTATGTTGG - Intergenic
1159277310 18:66237175-66237197 TAAGAAGGGAACTATGATGTTGG + Intergenic
1159848465 18:73495575-73495597 TAATAATGACACTTTGCTGCTGG + Intergenic
1159963040 18:74570353-74570375 TAAGGAAGAGACTTTGATCTGGG + Intronic
1161156602 19:2735058-2735080 TGAGAAGGCCACTGTGATGAGGG + Intronic
1161540300 19:4846801-4846823 CCAGAAGGACACTCTGATCTTGG + Intronic
1164440814 19:28278201-28278223 TAAGATGGATTCTTGGATGTTGG - Intergenic
1164884862 19:31769919-31769941 TGAGAAGGACAAGGTGATGTGGG + Intergenic
1165650649 19:37485717-37485739 TAAAAAGAACACTTTGAGGCTGG - Exonic
1166270438 19:41710250-41710272 GAGGAAGGACAGTCTGATGTGGG + Intronic
1166406711 19:42526810-42526832 GAGGAAGGACAATCTGATGTGGG - Intronic
1166468263 19:43054175-43054197 CAAGAAGGACAATTTCATGGAGG + Intronic
928506517 2:31959101-31959123 TAAGATGAAGACTTTGATTTTGG + Intronic
928995213 2:37282136-37282158 TAAGAACAACCCTTTGAGGTAGG - Intronic
929601873 2:43209663-43209685 TAATAAGAACACTTTGAGGGAGG + Intergenic
929738500 2:44577085-44577107 TAGGAAAGTCACTTTGATGCTGG + Intronic
931538217 2:63301471-63301493 GAAGAAGGCCACTTTAATGGAGG - Intronic
931968300 2:67557934-67557956 TGAAAAGAACACTTTGATGCTGG + Intergenic
933203591 2:79479302-79479324 TAAAAAGGACATTTTGAGGAAGG - Intronic
933489924 2:82972978-82973000 AAAGAAGGCCACTGGGATGTTGG - Intergenic
933744125 2:85558308-85558330 TTACAAGGTCACTTTGATCTAGG - Intronic
934114113 2:88766995-88767017 TTAGAGGGAAACTTTGAAGTGGG + Intergenic
934584079 2:95474248-95474270 TGAGAAGGGCACTTTGTTCTGGG + Intergenic
934595373 2:95602466-95602488 TGAGAAGGGCACTTTGTTCTGGG - Intergenic
934635919 2:95990699-95990721 TTAGAGGGAAACTTTGAAGTGGG - Intronic
934787398 2:97023068-97023090 TGAGAAGGGCACTTTGTTCTGGG + Intergenic
934797735 2:97114735-97114757 TTAGAGGGAAACTTTGAAGTGGG + Intronic
934835681 2:97588704-97588726 TTAGAGGGAAACTTTGAAGTGGG - Intronic
934905777 2:98201000-98201022 TAATAAAGACAATGTGATGTTGG - Intronic
934952695 2:98589138-98589160 TGTGAAGGACACTTTAATGAAGG + Exonic
935516875 2:104051268-104051290 TAAAAGGGACACTTTGGTGCAGG + Intergenic
935873583 2:107480017-107480039 TAATCAGGACACTGTGGTGTTGG - Intergenic
935927457 2:108085736-108085758 TAAAAAGAACACATTGATGTAGG - Intergenic
936245834 2:110826605-110826627 AGAGAAGCACACTTTGTTGTTGG + Intronic
937769190 2:125698970-125698992 TCAGAAGGACAGTATGTTGTTGG - Intergenic
937827316 2:126381020-126381042 TAAGAATGTCACTTGGAGGTAGG - Intergenic
938528467 2:132160955-132160977 TTAGAAGGTAACTTTGAGGTGGG - Intronic
939299397 2:140315828-140315850 GAAGAGAGACTCTTTGATGTTGG + Intronic
945270643 2:207935871-207935893 TAAGCAGGACACTGACATGTAGG + Intronic
945677306 2:212870948-212870970 GAAGAAGGACAAATAGATGTTGG - Intergenic
946722495 2:222625168-222625190 TATGATGGACACTGTGATATTGG - Intronic
947153827 2:227140679-227140701 TAGGAAGGACAGTTTGATGAGGG - Intronic
948087182 2:235260987-235261009 CAAGGAGGAGACTTTCATGTCGG + Intergenic
1168947698 20:1775550-1775572 TAAGCAGGGCTCTTTGAGGTGGG + Intergenic
1170314290 20:15026615-15026637 TCAGAAGCACATTTTGATGCAGG - Intronic
1170771233 20:19334561-19334583 TAAGACAGTCACATTGATGTTGG - Intronic
1172326975 20:34043717-34043739 TAGGAAGGATTCTTTGTTGTGGG + Intronic
1172396188 20:34607428-34607450 TCAGACGGACACCTTGATGGCGG + Intronic
1174199652 20:48798372-48798394 TAAAAAGGACCCTTAGGTGTGGG - Intronic
1174563173 20:51445679-51445701 TAAGCAGGACACTTTCAGATGGG - Intronic
1175459475 20:59141273-59141295 TAAGAAGTCTACTTTGATCTTGG + Intergenic
1176768030 21:13038941-13038963 TTAGAAGGTAACTTTGAGGTGGG + Intergenic
1180432592 22:15265224-15265246 TTAGAAGGTAACTTTGAGGTGGG + Intergenic
1180515157 22:16133190-16133212 TTAGAAGGTAACTTTGAGGTGGG + Intergenic
1183879408 22:40814295-40814317 TAAGAAAGAATCCTTGATGTGGG - Intronic
949756432 3:7416392-7416414 CAAGAAAGACACATTCATGTGGG + Intronic
950034519 3:9875853-9875875 TAACAAGGACACTTTGATGCAGG + Intronic
950324500 3:12093608-12093630 TAGTAACGATACTTTGATGTGGG + Intronic
950950488 3:16993166-16993188 TAATAAGGTCACTTTCAGGTAGG + Intronic
952488840 3:33845590-33845612 TAAGAAGGACACTTTGATGTAGG + Intronic
954595229 3:51818855-51818877 GAGTAAGGACACTGTGATGTAGG - Intronic
955155460 3:56412733-56412755 TTATAATGACACTGTGATGTAGG - Intronic
956126753 3:66018096-66018118 AAGGAAGGACACTTTGGTGGGGG + Intronic
958131623 3:89433655-89433677 TAAGAACAACATTTTTATGTAGG - Intronic
958782098 3:98555123-98555145 GGAAAAGGAAACTTTGATGTTGG - Intronic
960318846 3:116209603-116209625 TAAGAGGGGGGCTTTGATGTCGG + Intronic
960511199 3:118551508-118551530 TAATAAAAACACTCTGATGTAGG + Intergenic
961032010 3:123614452-123614474 TAAGGAGAAAATTTTGATGTTGG + Intronic
962462816 3:135630341-135630363 CAAAATGGACACTTTGATGGAGG - Intergenic
963423355 3:145090919-145090941 TATCAGGGACACCTTGATGTTGG + Intergenic
963582395 3:147142660-147142682 TAAGGAGGAAACTTAAATGTCGG - Intergenic
964306230 3:155343327-155343349 TAAAAAAGACACATTGATATTGG - Intergenic
965743035 3:171896833-171896855 TGAGAAGCATACTTGGATGTGGG + Intronic
966682503 3:182657669-182657691 TAAGAAGTACAGTTTGCTGAGGG - Intergenic
967668243 3:192200500-192200522 TAAGAAAGAAACTTTCACGTAGG + Intronic
968353145 3:198079920-198079942 TTAGAGGGACACTTGGAAGTGGG - Intergenic
969353279 4:6610613-6610635 TCAGAATGACCCTTTGATGAAGG - Intronic
970207012 4:13665253-13665275 TAAGAAAGACACTATGGGGTGGG - Intergenic
970553610 4:17209294-17209316 TAAGAAGGACACGTGGAGGAGGG - Intergenic
970570530 4:17377217-17377239 TAAGTTAGACACTTTGGTGTGGG + Intergenic
971505685 4:27364379-27364401 CATGAAGGAAACTATGATGTAGG - Intergenic
971729989 4:30365769-30365791 CAAGAAGAACACTTTCATATTGG + Intergenic
974152575 4:58028319-58028341 TGAAAAGCACACTTTGATTTTGG - Intergenic
975555997 4:75665231-75665253 TAAGAAGGACAGTTAGAGGAGGG - Intronic
975949909 4:79757497-79757519 TCAGAAGGAGACTTTCATTTTGG + Intergenic
976020454 4:80617671-80617693 TATGATGGGCACTTTTATGTAGG - Intronic
977871759 4:102098771-102098793 TAATGAGCACTCTTTGATGTGGG - Intergenic
978921960 4:114194636-114194658 TAAGTGAGACACTTTGATGCAGG + Intergenic
979410454 4:120371970-120371992 TAAGGAGCACACTTGGATTTAGG - Intergenic
980168988 4:129264081-129264103 AAAGAAGTACACAGTGATGTGGG - Intergenic
980535055 4:134108845-134108867 TAAGGAGGACATTTTTATATAGG + Intergenic
980982205 4:139664489-139664511 GCAGAAGGACACCTTCATGTTGG - Intergenic
982476283 4:155855245-155855267 TTAAAAGAACACTTTGAGGTAGG - Intronic
985700641 5:1369887-1369909 AAGGAAGGACACTTGGTTGTGGG + Intergenic
986631373 5:9776743-9776765 TAAGAAGGAAAATGTGGTGTGGG - Intergenic
988191592 5:27943956-27943978 GAAGAAGCACAGTTTGAGGTGGG - Intergenic
990074664 5:51829191-51829213 TATGAAGTGCACATTGATGTGGG - Intergenic
990705983 5:58530446-58530468 AAAGAAGGACAATTTGAAGTGGG + Intergenic
993026389 5:82651963-82651985 TAAATAAGAGACTTTGATGTAGG + Intergenic
993379008 5:87184135-87184157 TGAGAAAGAAAATTTGATGTAGG - Intergenic
996792555 5:127308216-127308238 TAACAAAGTCACTTTGATTTTGG - Intronic
998901467 5:146859886-146859908 TATGAAGGACAGTTTTGTGTAGG + Intronic
1000087617 5:157901821-157901843 TAAGAAGGCCACTTTAAGGAGGG - Intergenic
1000687572 5:164271760-164271782 TAAGAAGGAAAATATGATTTTGG + Intergenic
1000716629 5:164652332-164652354 AAAGAAAGACACTTGGATATGGG - Intergenic
1001060442 5:168483799-168483821 TTACAAGAACACTTTGATTTTGG + Intergenic
1001984669 5:176062610-176062632 TTAGAAGGAAACTTGGAAGTGGG + Intronic
1002232844 5:177781587-177781609 TTAGAAGGAAACTTGGAAGTGGG - Intronic
1002263144 5:178008228-178008250 TTAGAAGGAAACTTGGAAGTGGG + Intronic
1004527678 6:16424558-16424580 TAAAATGGCCACTTTGTTGTGGG - Intronic
1004795043 6:19072820-19072842 TAACAAGGACACATTGAAGAGGG + Intergenic
1007621071 6:43215037-43215059 CAAGAAGTCCACTTTTATGTAGG - Intronic
1007625860 6:43246121-43246143 TTAGCAGGTCACTTTGGTGTGGG + Intronic
1008135754 6:47774859-47774881 TAAGAAGGACTTTTGGATGTAGG + Intergenic
1009629393 6:66173980-66174002 CAAGAAGGACAGTTTCATGGGGG + Intergenic
1011932274 6:92729117-92729139 TAATAAGAACACTTGGATATAGG - Intergenic
1012383984 6:98655740-98655762 TGAGAAGGACACTATTATATAGG - Intergenic
1012636837 6:101553654-101553676 AAAGAAGGAAACTTTGACCTTGG - Intronic
1012647003 6:101697821-101697843 TTAGAGTGACACTGTGATGTAGG - Intronic
1014297647 6:119640134-119640156 TTAGAATGACACTATGAAGTAGG + Intergenic
1015707824 6:136107607-136107629 TGACAAGGACACTTCGAAGTGGG + Intronic
1016085489 6:139908938-139908960 CAAGAAGGACACTTTGGATTGGG + Intergenic
1016587288 6:145704061-145704083 TAAGCAGATTACTTTGATGTAGG - Intronic
1016825683 6:148386563-148386585 TAACAAGTACACTTGGCTGTTGG + Intronic
1017075415 6:150613146-150613168 TAATAAGAACACTCTGATGCTGG - Intronic
1017592904 6:155996264-155996286 TAAGAAGAATGCTTGGATGTTGG + Intergenic
1018784879 6:167100280-167100302 CAAGAAGGAATCTTTGATGTGGG + Intergenic
1021785292 7:24145390-24145412 GCAGAAGGACAGTTTGGTGTTGG - Intergenic
1024110315 7:46138896-46138918 TAATCAGGACTATTTGATGTTGG - Intergenic
1024693123 7:51824571-51824593 TAACAAGTCCATTTTGATGTAGG - Intergenic
1024808060 7:53171109-53171131 TAAGAAGTTCACATTCATGTGGG - Intergenic
1024829747 7:53436675-53436697 TAAGAAGCAAATTTTGAAGTAGG - Intergenic
1026342949 7:69449673-69449695 TAAGAACAACACTGTGAGGTAGG - Intergenic
1028202912 7:87983293-87983315 TAAAAAATACACTGTGATGTTGG - Intronic
1030241333 7:107329261-107329283 TAAGAAGGACACATAGCTGTTGG + Intronic
1030316981 7:108126232-108126254 TAAGATGGTCAATTTTATGTAGG - Intronic
1031747638 7:125523486-125523508 TAAAAATGACACTTTGACTTTGG + Intergenic
1034596730 7:152202661-152202683 TAACAAGGACACTTTGGGATAGG - Intronic
1035520579 8:272890-272912 TAAGAAGGAAAGCTTGATATGGG + Intergenic
1035603388 8:912645-912667 GAAGATGGACACTGTGGTGTGGG - Intergenic
1035603423 8:912810-912832 GAAGATGGACACTGTGGTGTGGG - Intergenic
1035952583 8:4039733-4039755 TAAGAAAGATAAATTGATGTGGG + Intronic
1036070820 8:5439512-5439534 TGTGAAGGACACTTTGAACTGGG + Intergenic
1038703570 8:29873724-29873746 TCAGAAGGACACCTTGATTTTGG - Intergenic
1038922095 8:32095967-32095989 TGAGAAGGAGACTTTGAGCTTGG + Intronic
1040794406 8:51273361-51273383 TCAGAAGAACACTTTGATTTTGG + Intergenic
1041044538 8:53878516-53878538 TAAGAAGGACACATGGAGTTTGG + Intronic
1041374151 8:57194529-57194551 TTAGAAGGAAACTTTGAAGTGGG + Intergenic
1041382301 8:57262177-57262199 TTAGAAGGACACTTTGAAGTGGG + Intergenic
1041384294 8:57281286-57281308 TTAGAAGGAAACTTTGAAGTAGG + Intergenic
1041691253 8:60689833-60689855 TAAGCTGAATACTTTGATGTCGG - Intronic
1042931181 8:74015524-74015546 TAATAAGGACACTTGCATATTGG + Intronic
1048488936 8:134874019-134874041 TAAGAAAGATACTTTGTTTTAGG - Intergenic
1048523311 8:135177600-135177622 TAAGGAGGACACTTTGATTCTGG + Intergenic
1048561170 8:135539101-135539123 TAAACAGGACACTTTGGTGAAGG + Intronic
1049056787 8:140243152-140243174 TAGCAAAGACACTTTGATGCAGG + Intronic
1050264714 9:3878169-3878191 AAAGAAAGACACAGTGATGTAGG - Intronic
1050268958 9:3921207-3921229 TGAGAAGGGCACTTTCTTGTGGG - Intronic
1051506642 9:17834433-17834455 TAAGAAGCAGAGTTTGAGGTGGG + Intergenic
1052041478 9:23743912-23743934 TATGAAGGACCATCTGATGTGGG + Intronic
1052872973 9:33525072-33525094 TTAGAGGGACACTTGGAAGTGGG + Intronic
1053167365 9:35854033-35854055 TAAGAAGGACTCCATGATGCAGG - Exonic
1053707085 9:40767288-40767310 TTAGAAGGTAACTTTGAGGTGGG - Intergenic
1054416999 9:64888056-64888078 TTAGAAGGTAACTTTGAGGTGGG - Intergenic
1054714814 9:68546818-68546840 TCAGAAGGTCACTTTGGTTTAGG + Intergenic
1056958732 9:91103224-91103246 TAATAAGGACACTGTCATATTGG - Intergenic
1057504270 9:95619816-95619838 TAAGACAGACACCTTGCTGTAGG + Intergenic
1057684452 9:97220636-97220658 TTAGAGGGACACTTGGAAGTGGG - Intergenic
1187845730 X:23534769-23534791 TAAAAAAGACACTTTTATGCTGG + Intergenic
1190381807 X:49846556-49846578 TAAGAAAGACACTATGTTTTGGG - Intergenic
1190639477 X:52468952-52468974 TAATCAGGACACTGTGATATTGG - Intergenic
1190640511 X:52479523-52479545 TAATCAGGACACTGTGATATTGG - Intergenic
1190647161 X:52533342-52533364 TAATCAGGACACTGTGATATTGG + Intergenic
1190649294 X:52553522-52553544 TAATCAGGACACTGTGATATTGG + Intergenic
1191780187 X:64856282-64856304 TAAGAGGGATACTTTTAAGTAGG + Intergenic
1202148676 Y:21825370-21825392 TTAGAAGGACACCTTGGTGGAGG + Intergenic
1202584830 Y:26410736-26410758 TTAGAGGGAAACTTTGAAGTGGG + Intergenic