ID: 952491323

View in Genome Browser
Species Human (GRCh38)
Location 3:33876455-33876477
Sequence CATGGGGGCCCCTCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952491313_952491323 21 Left 952491313 3:33876411-33876433 CCACGAGACCCTGGTAGGGCTTT No data
Right 952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG No data
952491316_952491323 12 Left 952491316 3:33876420-33876442 CCTGGTAGGGCTTTTGCAGGTGA No data
Right 952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG No data
952491315_952491323 13 Left 952491315 3:33876419-33876441 CCCTGGTAGGGCTTTTGCAGGTG No data
Right 952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952491323 Original CRISPR CATGGGGGCCCCTCTGGGCC TGG Intergenic
No off target data available for this crispr