ID: 952492876

View in Genome Browser
Species Human (GRCh38)
Location 3:33888556-33888578
Sequence CCCTATGGTGGGGGCCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952492866_952492876 -4 Left 952492866 3:33888537-33888559 CCCAAGGAGTCAGACAGGGCCCT No data
Right 952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG No data
952492867_952492876 -5 Left 952492867 3:33888538-33888560 CCAAGGAGTCAGACAGGGCCCTA No data
Right 952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG No data
952492863_952492876 10 Left 952492863 3:33888523-33888545 CCAGGGGGTGTAAGCCCAAGGAG No data
Right 952492876 3:33888556-33888578 CCCTATGGTGGGGGCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952492876 Original CRISPR CCCTATGGTGGGGGCCTCTG GGG Intergenic
No off target data available for this crispr