ID: 952493428

View in Genome Browser
Species Human (GRCh38)
Location 3:33894299-33894321
Sequence CAGTTTCACCCCAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952493428_952493434 -2 Left 952493428 3:33894299-33894321 CCTGCATCCCTGGGGTGAAACTG No data
Right 952493434 3:33894320-33894342 TGTGGGTTGGCAATTTGTGCTGG No data
952493428_952493436 21 Left 952493428 3:33894299-33894321 CCTGCATCCCTGGGGTGAAACTG No data
Right 952493436 3:33894343-33894365 CATCAGCTAGGTGATTCTTATGG No data
952493428_952493435 9 Left 952493428 3:33894299-33894321 CCTGCATCCCTGGGGTGAAACTG No data
Right 952493435 3:33894331-33894353 AATTTGTGCTGGCATCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952493428 Original CRISPR CAGTTTCACCCCAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr