ID: 952493428 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:33894299-33894321 |
Sequence | CAGTTTCACCCCAGGGATGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952493428_952493434 | -2 | Left | 952493428 | 3:33894299-33894321 | CCTGCATCCCTGGGGTGAAACTG | No data | ||
Right | 952493434 | 3:33894320-33894342 | TGTGGGTTGGCAATTTGTGCTGG | No data | ||||
952493428_952493436 | 21 | Left | 952493428 | 3:33894299-33894321 | CCTGCATCCCTGGGGTGAAACTG | No data | ||
Right | 952493436 | 3:33894343-33894365 | CATCAGCTAGGTGATTCTTATGG | No data | ||||
952493428_952493435 | 9 | Left | 952493428 | 3:33894299-33894321 | CCTGCATCCCTGGGGTGAAACTG | No data | ||
Right | 952493435 | 3:33894331-33894353 | AATTTGTGCTGGCATCAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952493428 | Original CRISPR | CAGTTTCACCCCAGGGATGC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |