ID: 952495774

View in Genome Browser
Species Human (GRCh38)
Location 3:33914700-33914722
Sequence CCTGCTCAGTTCTCAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952495774_952495784 24 Left 952495774 3:33914700-33914722 CCTCAGCCTGAGAACTGAGCAGG No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data
952495774_952495779 5 Left 952495774 3:33914700-33914722 CCTCAGCCTGAGAACTGAGCAGG No data
Right 952495779 3:33914728-33914750 CTATCACCCACCACTGTCCTGGG No data
952495774_952495778 4 Left 952495774 3:33914700-33914722 CCTCAGCCTGAGAACTGAGCAGG No data
Right 952495778 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952495774 Original CRISPR CCTGCTCAGTTCTCAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr