ID: 952495777

View in Genome Browser
Species Human (GRCh38)
Location 3:33914727-33914749
Sequence CCAGGACAGTGGTGGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952495777_952495788 10 Left 952495777 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data
Right 952495788 3:33914760-33914782 CTCTTCATGGTGTCACCTCAGGG No data
952495777_952495790 30 Left 952495777 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data
Right 952495790 3:33914780-33914802 GGGCCCAAAGCCCCCAGAGCTGG No data
952495777_952495787 9 Left 952495777 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data
Right 952495787 3:33914759-33914781 ACTCTTCATGGTGTCACCTCAGG No data
952495777_952495784 -3 Left 952495777 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952495777 Original CRISPR CCAGGACAGTGGTGGGTGAT AGG (reversed) Intergenic
No off target data available for this crispr