ID: 952495780

View in Genome Browser
Species Human (GRCh38)
Location 3:33914734-33914756
Sequence GTGTCGCCCAGGACAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952495780_952495790 23 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495790 3:33914780-33914802 GGGCCCAAAGCCCCCAGAGCTGG No data
952495780_952495787 2 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495787 3:33914759-33914781 ACTCTTCATGGTGTCACCTCAGG No data
952495780_952495791 24 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495791 3:33914781-33914803 GGCCCAAAGCCCCCAGAGCTGGG No data
952495780_952495788 3 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495788 3:33914760-33914782 CTCTTCATGGTGTCACCTCAGGG No data
952495780_952495784 -10 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952495780 Original CRISPR GTGTCGCCCAGGACAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr