ID: 952495784

View in Genome Browser
Species Human (GRCh38)
Location 3:33914747-33914769
Sequence TGGGCGACACCCACTCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952495776_952495784 18 Left 952495776 3:33914706-33914728 CCTGAGAACTGAGCAGGATTGCC No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data
952495777_952495784 -3 Left 952495777 3:33914727-33914749 CCTATCACCCACCACTGTCCTGG No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data
952495774_952495784 24 Left 952495774 3:33914700-33914722 CCTCAGCCTGAGAACTGAGCAGG No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data
952495780_952495784 -10 Left 952495780 3:33914734-33914756 CCCACCACTGTCCTGGGCGACAC No data
Right 952495784 3:33914747-33914769 TGGGCGACACCCACTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952495784 Original CRISPR TGGGCGACACCCACTCTTCA TGG Intergenic
No off target data available for this crispr