ID: 952502569

View in Genome Browser
Species Human (GRCh38)
Location 3:33977763-33977785
Sequence TCACCTCCAAGTGTTCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952502569_952502575 12 Left 952502569 3:33977763-33977785 CCATCAAGAACACTTGGAGGTGA No data
Right 952502575 3:33977798-33977820 AGCTGCTGTCCCCAGAGGTTTGG No data
952502569_952502574 7 Left 952502569 3:33977763-33977785 CCATCAAGAACACTTGGAGGTGA No data
Right 952502574 3:33977793-33977815 GAGGCAGCTGCTGTCCCCAGAGG No data
952502569_952502579 23 Left 952502569 3:33977763-33977785 CCATCAAGAACACTTGGAGGTGA No data
Right 952502579 3:33977809-33977831 CCAGAGGTTTGGAATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952502569 Original CRISPR TCACCTCCAAGTGTTCTTGA TGG (reversed) Intergenic