ID: 952502579

View in Genome Browser
Species Human (GRCh38)
Location 3:33977809-33977831
Sequence CCAGAGGTTTGGAATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952502569_952502579 23 Left 952502569 3:33977763-33977785 CCATCAAGAACACTTGGAGGTGA No data
Right 952502579 3:33977809-33977831 CCAGAGGTTTGGAATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952502579 Original CRISPR CCAGAGGTTTGGAATGCAGC AGG Intergenic