ID: 952506105

View in Genome Browser
Species Human (GRCh38)
Location 3:34008042-34008064
Sequence CAGGCTGGTGCTTCCCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952506105_952506113 10 Left 952506105 3:34008042-34008064 CCTCCTCGGGAAGCACCAGCCTG No data
Right 952506113 3:34008075-34008097 ACAGGAACTCTAATGGTTTTTGG No data
952506105_952506112 3 Left 952506105 3:34008042-34008064 CCTCCTCGGGAAGCACCAGCCTG No data
Right 952506112 3:34008068-34008090 ATTGATGACAGGAACTCTAATGG No data
952506105_952506110 -8 Left 952506105 3:34008042-34008064 CCTCCTCGGGAAGCACCAGCCTG No data
Right 952506110 3:34008057-34008079 CCAGCCTGGGCATTGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952506105 Original CRISPR CAGGCTGGTGCTTCCCGAGG AGG (reversed) Intergenic
No off target data available for this crispr