ID: 952507844

View in Genome Browser
Species Human (GRCh38)
Location 3:34023900-34023922
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952507841_952507844 -10 Left 952507841 3:34023887-34023909 CCCCTGCAGGAAGCTCCATGTTC No data
Right 952507844 3:34023900-34023922 CTCCATGTTCATGCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr