ID: 952509142

View in Genome Browser
Species Human (GRCh38)
Location 3:34036486-34036508
Sequence GCCTTGGCTCCATATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952509142_952509149 25 Left 952509142 3:34036486-34036508 CCAGGGTGATATGGAGCCAAGGC No data
Right 952509149 3:34036534-34036556 CCTAAGAACTGACACATTTGTGG No data
952509142_952509146 -1 Left 952509142 3:34036486-34036508 CCAGGGTGATATGGAGCCAAGGC No data
Right 952509146 3:34036508-34036530 CCACAATCAGAAGTAGTTTTGGG No data
952509142_952509144 -2 Left 952509142 3:34036486-34036508 CCAGGGTGATATGGAGCCAAGGC No data
Right 952509144 3:34036507-34036529 GCCACAATCAGAAGTAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952509142 Original CRISPR GCCTTGGCTCCATATCACCC TGG (reversed) Intergenic
No off target data available for this crispr