ID: 952512293

View in Genome Browser
Species Human (GRCh38)
Location 3:34069594-34069616
Sequence ATGTGTCAGGCACTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952512288_952512293 -4 Left 952512288 3:34069575-34069597 CCTTTATTGAGTGCTTGCCATGT No data
Right 952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG No data
952512287_952512293 -3 Left 952512287 3:34069574-34069596 CCCTTTATTGAGTGCTTGCCATG No data
Right 952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952512293 Original CRISPR ATGTGTCAGGCACTGTGTTG GGG Intergenic
No off target data available for this crispr