ID: 952512872

View in Genome Browser
Species Human (GRCh38)
Location 3:34074752-34074774
Sequence CAAGACTCATTGTCTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952512872_952512875 6 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512875 3:34074781-34074803 ATGCTGAAGCTAAAAGGTGATGG No data
952512872_952512874 0 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG No data
952512872_952512877 10 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512877 3:34074785-34074807 TGAAGCTAAAAGGTGATGGGAGG No data
952512872_952512880 30 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512880 3:34074805-34074827 AGGTGGGAAGTAGAGATGAGTGG No data
952512872_952512878 13 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512878 3:34074788-34074810 AGCTAAAAGGTGATGGGAGGTGG No data
952512872_952512876 7 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512876 3:34074782-34074804 TGCTGAAGCTAAAAGGTGATGGG No data
952512872_952512879 14 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512879 3:34074789-34074811 GCTAAAAGGTGATGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952512872 Original CRISPR CAAGACTCATTGTCTCTCTG TGG (reversed) Intergenic
No off target data available for this crispr