ID: 952512874

View in Genome Browser
Species Human (GRCh38)
Location 3:34074775-34074797
Sequence CAGGACATGCTGAAGCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952512871_952512874 13 Left 952512871 3:34074739-34074761 CCAGGGAAGGTTTCCACAGAGAG No data
Right 952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG No data
952512872_952512874 0 Left 952512872 3:34074752-34074774 CCACAGAGAGACAATGAGTCTTG No data
Right 952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952512874 Original CRISPR CAGGACATGCTGAAGCTAAA AGG Intergenic
No off target data available for this crispr