ID: 952519786

View in Genome Browser
Species Human (GRCh38)
Location 3:34145207-34145229
Sequence CACTCTGAGAAGAGGGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952519782_952519786 -6 Left 952519782 3:34145190-34145212 CCTGCTGAGGGAATAGACACTCT No data
Right 952519786 3:34145207-34145229 CACTCTGAGAAGAGGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952519786 Original CRISPR CACTCTGAGAAGAGGGACTT GGG Intergenic
No off target data available for this crispr