ID: 952525006

View in Genome Browser
Species Human (GRCh38)
Location 3:34200732-34200754
Sequence ACTGACAAATGTCTCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952525006_952525008 11 Left 952525006 3:34200732-34200754 CCAGCTGTGAGACATTTGTCAGT No data
Right 952525008 3:34200766-34200788 TGTACTTTCTGCTTCCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952525006 Original CRISPR ACTGACAAATGTCTCACAGC TGG (reversed) Intergenic
No off target data available for this crispr