ID: 952525008

View in Genome Browser
Species Human (GRCh38)
Location 3:34200766-34200788
Sequence TGTACTTTCTGCTTCCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952525005_952525008 30 Left 952525005 3:34200713-34200735 CCTGCATCTCAGTGGAAAGCCAG No data
Right 952525008 3:34200766-34200788 TGTACTTTCTGCTTCCTGTTTGG No data
952525006_952525008 11 Left 952525006 3:34200732-34200754 CCAGCTGTGAGACATTTGTCAGT No data
Right 952525008 3:34200766-34200788 TGTACTTTCTGCTTCCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952525008 Original CRISPR TGTACTTTCTGCTTCCTGTT TGG Intergenic
No off target data available for this crispr