ID: 952525893

View in Genome Browser
Species Human (GRCh38)
Location 3:34210341-34210363
Sequence CTCAAGTAGTTTAGAGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952525891_952525893 10 Left 952525891 3:34210308-34210330 CCGGGGAGAGATGAAAACAACAC No data
Right 952525893 3:34210341-34210363 CTCAAGTAGTTTAGAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952525893 Original CRISPR CTCAAGTAGTTTAGAGTCCT GGG Intergenic
No off target data available for this crispr