ID: 952533459

View in Genome Browser
Species Human (GRCh38)
Location 3:34286245-34286267
Sequence GAGGAAGACCTGACAAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952533455_952533459 5 Left 952533455 3:34286217-34286239 CCAAGCCTCACTTTATTAAAATA No data
Right 952533459 3:34286245-34286267 GAGGAAGACCTGACAAGGAGTGG No data
952533456_952533459 0 Left 952533456 3:34286222-34286244 CCTCACTTTATTAAAATATCTCA No data
Right 952533459 3:34286245-34286267 GAGGAAGACCTGACAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952533459 Original CRISPR GAGGAAGACCTGACAAGGAG TGG Intergenic
No off target data available for this crispr