ID: 952536053

View in Genome Browser
Species Human (GRCh38)
Location 3:34310208-34310230
Sequence CAGATGCCCATATGGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952536053_952536056 11 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536056 3:34310242-34310264 AACAGTCAAGACTGACATCCAGG No data
952536053_952536062 28 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG No data
952536053_952536057 12 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536057 3:34310243-34310265 ACAGTCAAGACTGACATCCAGGG No data
952536053_952536058 17 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536058 3:34310248-34310270 CAAGACTGACATCCAGGGCCCGG No data
952536053_952536060 21 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536060 3:34310252-34310274 ACTGACATCCAGGGCCCGGGAGG No data
952536053_952536059 18 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536059 3:34310249-34310271 AAGACTGACATCCAGGGCCCGGG No data
952536053_952536061 27 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536061 3:34310258-34310280 ATCCAGGGCCCGGGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952536053 Original CRISPR CAGATGCCCATATGGCATCT AGG (reversed) Intergenic