ID: 952536056

View in Genome Browser
Species Human (GRCh38)
Location 3:34310242-34310264
Sequence AACAGTCAAGACTGACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952536050_952536056 25 Left 952536050 3:34310194-34310216 CCTGAATAAGAGTTCCTAGATGC No data
Right 952536056 3:34310242-34310264 AACAGTCAAGACTGACATCCAGG No data
952536053_952536056 11 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536056 3:34310242-34310264 AACAGTCAAGACTGACATCCAGG No data
952536054_952536056 3 Left 952536054 3:34310216-34310238 CCATATGGGCATCTGTAGTTAGG No data
Right 952536056 3:34310242-34310264 AACAGTCAAGACTGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952536056 Original CRISPR AACAGTCAAGACTGACATCC AGG Intergenic