ID: 952536059

View in Genome Browser
Species Human (GRCh38)
Location 3:34310249-34310271
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952536054_952536059 10 Left 952536054 3:34310216-34310238 CCATATGGGCATCTGTAGTTAGG No data
Right 952536059 3:34310249-34310271 AAGACTGACATCCAGGGCCCGGG No data
952536053_952536059 18 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536059 3:34310249-34310271 AAGACTGACATCCAGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type