ID: 952536061

View in Genome Browser
Species Human (GRCh38)
Location 3:34310258-34310280
Sequence ATCCAGGGCCCGGGAGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952536054_952536061 19 Left 952536054 3:34310216-34310238 CCATATGGGCATCTGTAGTTAGG No data
Right 952536061 3:34310258-34310280 ATCCAGGGCCCGGGAGGCTCTGG No data
952536053_952536061 27 Left 952536053 3:34310208-34310230 CCTAGATGCCATATGGGCATCTG No data
Right 952536061 3:34310258-34310280 ATCCAGGGCCCGGGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952536061 Original CRISPR ATCCAGGGCCCGGGAGGCTC TGG Intergenic