ID: 952541610

View in Genome Browser
Species Human (GRCh38)
Location 3:34373171-34373193
Sequence GAGGCTAGTCACACCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952541605_952541610 17 Left 952541605 3:34373131-34373153 CCAAGGGAGGAATAGTACCTCCA No data
Right 952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG No data
952541607_952541610 -3 Left 952541607 3:34373151-34373173 CCAGCTCTTGAAGAAACAGAGAG No data
Right 952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG No data
952541606_952541610 0 Left 952541606 3:34373148-34373170 CCTCCAGCTCTTGAAGAAACAGA No data
Right 952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952541610 Original CRISPR GAGGCTAGTCACACCAGCCA GGG Intergenic
No off target data available for this crispr