ID: 952546445

View in Genome Browser
Species Human (GRCh38)
Location 3:34424908-34424930
Sequence CCTGCTTTGCAGTGGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952546439_952546445 21 Left 952546439 3:34424864-34424886 CCATTTTTTTTTTCTTTTTGTGA 0: 3
1: 163
2: 5107
3: 8658
4: 43947
Right 952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952546445 Original CRISPR CCTGCTTTGCAGTGGCTGAA TGG Intergenic
No off target data available for this crispr