ID: 952549216

View in Genome Browser
Species Human (GRCh38)
Location 3:34457094-34457116
Sequence TCATGCCCACAAGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952549212_952549216 24 Left 952549212 3:34457047-34457069 CCACACTGATGTTAGCAGAATCT No data
Right 952549216 3:34457094-34457116 TCATGCCCACAAGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952549216 Original CRISPR TCATGCCCACAAGTGGTGCA TGG Intergenic
No off target data available for this crispr